ID: 901629732

View in Genome Browser
Species Human (GRCh38)
Location 1:10642230-10642252
Sequence ATGGAGTCGCTGGCGGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901629725_901629732 0 Left 901629725 1:10642207-10642229 CCGGAGCGTGGCCGGCGAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 901629732 1:10642230-10642252 ATGGAGTCGCTGGCGGCTGCGGG 0: 1
1: 0
2: 1
3: 7
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901629732 Original CRISPR ATGGAGTCGCTGGCGGCTGC GGG Intronic
900402864 1:2479727-2479749 ATGGAGTCGATGGAGACTGCGGG - Exonic
901231883 1:7646144-7646166 ATGGAGGCCCTGGTGACTGCAGG + Intronic
901629732 1:10642230-10642252 ATGGAGTCGCTGGCGGCTGCGGG + Intronic
902400343 1:16153877-16153899 ATGGCCTAGCTGGCAGCTGCTGG - Intronic
903459439 1:23510104-23510126 ATGGAGGCGGTGGGGCCTGCTGG + Exonic
906678720 1:47710685-47710707 CCGGAGGCGCAGGCGGCTGCTGG + Intergenic
912413630 1:109494056-109494078 GCGGAGGCGGTGGCGGCTGCAGG - Intronic
914944096 1:152048350-152048372 CTGGAGTGGCTAGAGGCTGCTGG + Intergenic
915551513 1:156638115-156638137 ATGGGGACGCTGGCTCCTGCTGG + Intergenic
916952435 1:169794709-169794731 TTGGAGTCACTTCCGGCTGCAGG + Intronic
918133289 1:181647183-181647205 ATGGAGGGGCTGGCGTCTTCTGG + Intronic
918338141 1:183542194-183542216 ATAGAGTCGCTGGCTGCAGATGG + Exonic
1063666183 10:8062009-8062031 TTTGTGTCGCTGGTGGCTGCTGG - Intronic
1067083847 10:43228011-43228033 ATGGCATTGCTGGCTGCTGCTGG - Intronic
1075835171 10:125446877-125446899 ATTCAGTAGCTGGTGGCTGCTGG + Intergenic
1078659847 11:13277936-13277958 ATCGCGTCGCTGGCCGCCGCCGG - Intronic
1083048275 11:59755469-59755491 CTGGAGGCGCAGGCGGCGGCGGG - Exonic
1083679590 11:64344984-64345006 GTGGAGGCGCTGGCAGCAGCGGG + Exonic
1083753715 11:64778131-64778153 GTGGAGGCGGCGGCGGCTGCTGG + Exonic
1084477127 11:69395446-69395468 ATGCAGTGGCTGGTGGCAGCTGG + Intergenic
1084592648 11:70099398-70099420 AAGGAGCCGGTGGCTGCTGCTGG - Intronic
1085532085 11:77197898-77197920 ATGGAGTCGCTACCGGGTGTTGG - Intronic
1095687519 12:45051650-45051672 ACGGAGTCGCTAGTGGCTGGAGG + Intergenic
1096370870 12:51067929-51067951 GTGGAGTCGGTGGAGGCTGATGG - Exonic
1096804114 12:54129854-54129876 ATGGAGGCACTTGGGGCTGCGGG - Intergenic
1102298909 12:111757335-111757357 ATGGAGCAGGTGGAGGCTGCAGG - Intronic
1108690055 13:52851446-52851468 ATCGAGTGGCTGTCCGCTGCCGG - Intergenic
1117119428 14:52552486-52552508 GCCGAGTCGGTGGCGGCTGCAGG - Exonic
1119464055 14:74839850-74839872 ATGGAGTCGTGGGAGGCTGAGGG - Intronic
1119484894 14:74980847-74980869 CTGCAGACCCTGGCGGCTGCCGG + Intergenic
1128392172 15:67189674-67189696 CTGGAGTCGCTGGTGCCAGCTGG - Intronic
1129320526 15:74772208-74772230 TTGGAGTCGCTGAGGGCTGCAGG + Intergenic
1132547660 16:540663-540685 CTGGGGTCGCTGGCGGCTGCAGG + Intronic
1132605529 16:792276-792298 ATGGAGTCGGTGCTGGGTGCTGG + Exonic
1132951115 16:2562976-2562998 ATGGAGTCAGGGGCGGCTCCTGG + Intronic
1135627728 16:24010775-24010797 ATGAAGTCACTGGCAGCAGCAGG - Intronic
1139102018 16:63779232-63779254 ATGGATTGGCTGGTCGCTGCTGG - Intergenic
1139653064 16:68372217-68372239 ATGGTGTCCGTGGCAGCTGCGGG + Exonic
1143499494 17:7330461-7330483 GTGGAGTCCCTAGGGGCTGCTGG + Intergenic
1145953766 17:28840612-28840634 AAGGAGTCTCTGGCTGCTCCGGG - Intronic
1147608156 17:41785875-41785897 ATGGAGTGACTGGGGGGTGCAGG - Intronic
1147944808 17:44074893-44074915 ATGGAGTACCTGGGTGCTGCAGG + Intronic
1149891250 17:60392100-60392122 ATGGAGGCGGTGGCGGCGACCGG - Exonic
1153522737 18:5967730-5967752 ATGGAGCCCCAGGCTGCTGCTGG + Intronic
1160789545 19:917242-917264 AGGGAGTGGCGAGCGGCTGCCGG + Intergenic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1160966648 19:1749675-1749697 ATGGAGCCGCTCGCCGCGGCGGG + Intergenic
1163126007 19:15244507-15244529 GTGGAGGCGGTGGGGGCTGCTGG + Exonic
1163207669 19:15815484-15815506 TTGGAGTCCCTGGCAGGTGCTGG + Intergenic
1165914154 19:39247727-39247749 CTGGAGCTGCTGGCGGCCGCGGG - Intergenic
1166209707 19:41298435-41298457 CTGTGGTCGCTGGGGGCTGCTGG - Intronic
1166777055 19:45319464-45319486 ATGGGGGCTCTGGAGGCTGCCGG - Intronic
1168641318 19:58033806-58033828 GTGGAGACGGTGGCGGCTGCGGG - Intergenic
929787177 2:45001343-45001365 CTGGAGCCGCTGCCGGCGGCCGG - Intergenic
931986511 2:67747450-67747472 ATGGAGTCGATGGAGGCAGAGGG + Intergenic
932341397 2:70964700-70964722 AAGGCGTCGGTGGCCGCTGCGGG - Intronic
946399835 2:219462404-219462426 ATAGAGTCGCTGGTGGGTGGTGG - Intronic
948183474 2:236001135-236001157 ATGGAGACTCTGGCGGTGGCTGG + Intronic
948742017 2:240054366-240054388 CTGGAATCCCTGGCTGCTGCAGG + Intergenic
1175252612 20:57618516-57618538 ATGGAGGTGCTGCTGGCTGCCGG - Intronic
1176219803 20:63964534-63964556 ATGGAGGCACTGAAGGCTGCAGG - Exonic
1176302987 21:5107529-5107551 ATGGAGCCACTGCCGACTGCAGG - Intergenic
1179854038 21:44154395-44154417 ATGGAGCCACTGCCGACTGCAGG + Intergenic
1180167778 21:46038938-46038960 CTGGGGCCTCTGGCGGCTGCTGG + Intergenic
1181813772 22:25421376-25421398 AGGGGGTCGCTGGCGGCCGCAGG - Intergenic
1181831731 22:25565196-25565218 AGGGGGTAGCTGGCGGCCGCAGG - Intronic
1185171395 22:49296652-49296674 ATGGAGTCCCTGGCATGTGCTGG - Intergenic
953054058 3:39373406-39373428 ATGGACTAGCTGGCTGATGCAGG - Intergenic
956108435 3:65846160-65846182 TTGGAGGGGCTGGTGGCTGCTGG - Intronic
961603364 3:128076898-128076920 ATGGGGACGCCGGCAGCTGCGGG - Intronic
967271700 3:187738307-187738329 ATGGAGTCCCTAGGGGCTGAGGG + Intronic
968583063 4:1403800-1403822 AAGGGGTCGCCGGCGTCTGCGGG + Exonic
970585666 4:17512032-17512054 ATGGCGGCGGCGGCGGCTGCAGG - Exonic
972544831 4:40070572-40070594 CTGGAGTGGCTGGGGGCTACAGG + Intronic
975439490 4:74394684-74394706 AGGGAGTTGGTGGCGGCTGTTGG + Intergenic
985493374 5:191841-191863 CCGGAGCCGCCGGCGGCTGCGGG + Exonic
985947723 5:3199906-3199928 GGGGAGTCTCTGGGGGCTGCAGG + Intergenic
986338214 5:6770187-6770209 AAGGGGAGGCTGGCGGCTGCAGG + Intergenic
990042004 5:51387597-51387619 AGGGATGAGCTGGCGGCTGCAGG - Exonic
990616099 5:57510027-57510049 ATGGAGTCAGTGGTGACTGCGGG + Intergenic
996765154 5:127028965-127028987 ATGGGCCGGCTGGCGGCTGCTGG + Intronic
998368142 5:141644317-141644339 ATGGAGTAGATGACGGCTTCTGG - Exonic
1001438693 5:171721083-171721105 ATGGAGACACTCGCGGCTGTGGG - Intergenic
1001482083 5:172095559-172095581 ATGGAGCCCCTGGTGGCTGCCGG - Intronic
1005335878 6:24795805-24795827 GTGGAGTTGCGGGCTGCTGCAGG + Intergenic
1006715521 6:36117046-36117068 AAGGACTCCCTGGCTGCTGCTGG + Intergenic
1007341000 6:41191583-41191605 ATGGACTTCCTGGAGGCTGCTGG + Exonic
1009042038 6:58190786-58190808 ATGGAGTGGCTGGCCGGTGGAGG - Intergenic
1017339460 6:153304075-153304097 ATGGACTAGCGGGCGGTTGCAGG - Intergenic
1017856902 6:158357523-158357545 ATGGAATTGCTGGCCGCCGCAGG - Intronic
1019901296 7:4022589-4022611 ATGGAGAAGCTGTCTGCTGCAGG + Intronic
1019936251 7:4260127-4260149 ATGGAGAAGCTGGCTGCTCCGGG + Intronic
1019936260 7:4260189-4260211 ATGGAGAAGCTGGCTGCTCCGGG + Intronic
1019936269 7:4260251-4260273 ATGGAGAAGCTGGCTGCTCCAGG + Intronic
1019936280 7:4260313-4260335 ATGGAGAAGCTGGCTGCTCCGGG + Intronic
1019936291 7:4260375-4260397 ATGGAGAAGCTGGCTGCTCCGGG + Intronic
1019936302 7:4260437-4260459 ATGGAGAAGCTGGCTGCTCCGGG + Intronic
1019936311 7:4260499-4260521 ATGGAGAAGCTGGCTGCTCCGGG + Intronic
1019936320 7:4260559-4260581 ATGGAGAAGCTGGCTGCTCCGGG + Intronic
1019936330 7:4260621-4260643 ATGGAGAAGCTGGCTGCTCCGGG + Intronic
1019936351 7:4260745-4260767 ATGGAGAAGCTGGCTGCTCCGGG + Intronic
1019936360 7:4260807-4260829 ATGGAGAAGCTGGCTGCTCCGGG + Intronic
1019936370 7:4260869-4260891 ATGGAGAAGCTGGCTGCTCCGGG + Intronic
1022815092 7:33905581-33905603 AGGGAATCCCTGGCGACTGCAGG - Exonic
1022943745 7:35262100-35262122 ACGGTGTCGCTGGCGGCGGCGGG + Intergenic
1024004637 7:45216510-45216532 CTGGAGAAGCTGGCGGCTCCTGG + Intergenic
1024561850 7:50651336-50651358 CTGGAGGTTCTGGCGGCTGCTGG + Intronic
1035028643 7:155843614-155843636 ATGGAGAGGCTGGCACCTGCAGG + Intergenic
1036593888 8:10194790-10194812 TAGGAGTGGCTGGCAGCTGCAGG - Intronic
1039419031 8:37420290-37420312 ATGGAGGTGCTAGGGGCTGCTGG - Intergenic
1040594483 8:48824258-48824280 ATGGTGTCTCTAGCAGCTGCAGG - Intergenic
1042020616 8:64369556-64369578 ATAGAGGCGCTGGTGTCTGCGGG - Intergenic
1044602354 8:94018128-94018150 ATGGATTCGCTGGAGACTGAGGG - Intergenic
1045102550 8:98860266-98860288 ATGGAGTGGCTGGAGGTTGGTGG + Intronic
1052695652 9:31874001-31874023 ATGTTGTCTCTGGAGGCTGCAGG - Intergenic
1054825051 9:69565399-69565421 ATGGGCTCGCTGGAGACTGCTGG - Intronic
1061090427 9:128422911-128422933 CAGGAGTGGCTGGCGGCTGTGGG + Exonic
1062325069 9:136009034-136009056 AGGGAGCCGCTGGCTGCTGCCGG - Exonic
1187380307 X:18795501-18795523 CTGGAGTCTCTGGCAGCTTCTGG + Intronic
1195732563 X:107981441-107981463 AAGGAGGCGGTGGCTGCTGCTGG - Exonic
1197900431 X:131365988-131366010 CTGAACTCGCTGGGGGCTGCTGG - Intronic