ID: 901629807

View in Genome Browser
Species Human (GRCh38)
Location 1:10642592-10642614
Sequence GGGCTGCGCTGCTCCCGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 192}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901629798_901629807 13 Left 901629798 1:10642556-10642578 CCAGGCCGGGTGGGAGGCAGCGG 0: 1
1: 0
2: 4
3: 56
4: 957
Right 901629807 1:10642592-10642614 GGGCTGCGCTGCTCCCGCTGTGG 0: 1
1: 0
2: 3
3: 19
4: 192
901629793_901629807 25 Left 901629793 1:10642544-10642566 CCGGCGCTGGGCCCAGGCCGGGT 0: 1
1: 0
2: 1
3: 38
4: 305
Right 901629807 1:10642592-10642614 GGGCTGCGCTGCTCCCGCTGTGG 0: 1
1: 0
2: 3
3: 19
4: 192
901629797_901629807 14 Left 901629797 1:10642555-10642577 CCCAGGCCGGGTGGGAGGCAGCG 0: 1
1: 0
2: 1
3: 38
4: 313
Right 901629807 1:10642592-10642614 GGGCTGCGCTGCTCCCGCTGTGG 0: 1
1: 0
2: 3
3: 19
4: 192
901629801_901629807 8 Left 901629801 1:10642561-10642583 CCGGGTGGGAGGCAGCGGAGGAA 0: 1
1: 0
2: 3
3: 38
4: 398
Right 901629807 1:10642592-10642614 GGGCTGCGCTGCTCCCGCTGTGG 0: 1
1: 0
2: 3
3: 19
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901629807 Original CRISPR GGGCTGCGCTGCTCCCGCTG TGG Intronic
900399383 1:2466807-2466829 GTGCTGAGCTGCCCGCGCTGGGG - Intronic
900410539 1:2510620-2510642 GGGCTTCTCTGCTCTCGGTGGGG - Intronic
900503681 1:3018716-3018738 GGGCTGCTGAGCTCCCGGTGGGG - Intergenic
900627939 1:3618005-3618027 GGGCAGGGCAGCACCCGCTGTGG - Intergenic
900631685 1:3639734-3639756 GGGCTGCGCAGCTCCATGTGGGG + Intronic
901629807 1:10642592-10642614 GGGCTGCGCTGCTCCCGCTGTGG + Intronic
901761032 1:11471756-11471778 GGCCTGGGCTGCTCCCCATGTGG + Intergenic
904528990 1:31155530-31155552 GGGCCGCGCTCCACCCGCTTTGG + Intergenic
906650405 1:47508637-47508659 GGGCTGCGCTGGGCACGCCGAGG + Intergenic
907049790 1:51322177-51322199 TGGCTGGGCTGCACCCCCTGGGG - Intronic
907250397 1:53134269-53134291 TTGCTGCCCTGCTCCTGCTGTGG - Intronic
907316831 1:53577608-53577630 GGGTTGCCCTGCTACAGCTGTGG + Intronic
908789483 1:67767321-67767343 GGCCTGAGCTCCTCCCGCTTAGG + Intronic
912514838 1:110211013-110211035 CTGCTGCGCTGCCGCCGCTGCGG + Intergenic
912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG + Exonic
915146341 1:153797902-153797924 GGGCTCCTCTGCTCCTGCAGAGG - Intergenic
915740937 1:158117977-158117999 GGGCTGCGCTGCCCCGGCACGGG - Intergenic
916717013 1:167455050-167455072 CGCCTGGGCTCCTCCCGCTGCGG + Intronic
920380146 1:205530443-205530465 GGGCTGCTCTGCTGGGGCTGGGG - Intronic
921934928 1:220787241-220787263 GGGCAGCGCTGATCCGGCTCGGG + Intronic
922200076 1:223393860-223393882 GGGCAGGGCTGCGGCCGCTGGGG - Exonic
922526642 1:226309250-226309272 GCGCTGCGCTGCTCCCGCCGCGG + Exonic
922857846 1:228790367-228790389 GAGCTGAGCAGCTCCAGCTGGGG + Intergenic
924023729 1:239811439-239811461 GGGCTGGGCTGCAACAGCTGAGG - Intronic
924800949 1:247329466-247329488 GGGCTGGGAAGCTCCCCCTGGGG + Exonic
1062937418 10:1398825-1398847 AGGCTGCGCTGCTGCTGCGGAGG - Intronic
1064033564 10:11898558-11898580 GGGCTGGGCAGCTTCCGCTGAGG + Intergenic
1067077966 10:43198824-43198846 GGGCTGCCCTCCTCTCCCTGGGG - Intronic
1067806734 10:49397906-49397928 GGGCTGGGCTGCTGCCGCTGAGG - Intergenic
1070833502 10:79434182-79434204 GGGCTGGCCTGCCCCCGATGTGG - Intronic
1071997705 10:91163405-91163427 GGGAGCCGCTGCTCCCGCGGCGG - Intronic
1073639915 10:105241351-105241373 GGGCTGCTGCGCTCCCCCTGAGG - Intronic
1075057863 10:119233389-119233411 GGGCTGCTCTTCTGCTGCTGGGG + Intronic
1076800138 10:132817941-132817963 GGGCTGCGCTGCCGACGGTGAGG - Intronic
1076849997 10:133088061-133088083 GCGCTGCGCTCCCCCCGCCGGGG - Exonic
1077100318 11:819611-819633 GGGCCGGGCAGGTCCCGCTGCGG - Exonic
1077228335 11:1447961-1447983 GGGCTGCAGGGCTCCTGCTGCGG + Intronic
1084289198 11:68151010-68151032 GGGCTGCGCAGCTGGGGCTGGGG + Intergenic
1085680930 11:78574506-78574528 GGTCTGGGCTGCTCCCGCGGAGG - Exonic
1089188397 11:116636626-116636648 GGGCTCCACTCCTCCCTCTGCGG + Intergenic
1089566224 11:119373141-119373163 GGAATCCGCTGCCCCCGCTGAGG + Exonic
1091676971 12:2498670-2498692 GGGCTGTCCTGCTCCCACAGAGG - Intronic
1096472932 12:51890254-51890276 GGCCTGAGCTGCACCCTCTGGGG - Intronic
1097036783 12:56129390-56129412 GGGCTGCGCTTGTTCCGTTGGGG + Intronic
1100611562 12:96194990-96195012 GGGCTGCGCTGCGACCCCAGAGG + Intronic
1101330699 12:103755541-103755563 GGGCTGCACTGCTTCTGCTTGGG - Intronic
1103561671 12:121796132-121796154 GGGCCGCGCTGGGCCCACTGAGG + Intronic
1104943869 12:132407114-132407136 GGGCTGCGTGGCTGCAGCTGTGG - Intergenic
1104980238 12:132570329-132570351 GGGCGCTGCTGCTCCTGCTGCGG - Exonic
1105578896 13:21675511-21675533 GGGCTGCGGTGCCCCGGCTCTGG + Intronic
1112576724 13:100642815-100642837 GGTCTGCTCTGCTCCCTGTGTGG + Intronic
1113921762 13:113917302-113917324 GGGCTGAGCTGCTTCCCCCGTGG - Intergenic
1114163408 14:20193895-20193917 GGGCTCTCCTGCTCCCACTGAGG - Intergenic
1114655128 14:24311283-24311305 CGGCTGCGGGGCGCCCGCTGGGG + Exonic
1117478362 14:56118941-56118963 GGGCTGCGCTGTCCGCGCGGAGG + Intronic
1119705030 14:76778019-76778041 GGGCTGGACTGGGCCCGCTGCGG - Exonic
1120953080 14:90060619-90060641 GGGCTGCGGTGCTCCCACCAGGG - Intergenic
1121422108 14:93823593-93823615 GGGCTGAGCTGCTGGGGCTGGGG + Intergenic
1122226857 14:100285446-100285468 GGGCTGGGCCGCGTCCGCTGTGG + Intergenic
1123047736 14:105526892-105526914 GGGCTGCTGTGCTCCCGCCGCGG - Intronic
1123505582 15:20939761-20939783 GGGCTGCACTGCCCCCGGCGGGG - Intergenic
1123940969 15:25216499-25216521 GGGCAGCTCTGATCCTGCTGGGG + Intergenic
1124662081 15:31558033-31558055 GGGAAGCCCTGCTCCTGCTGGGG - Intronic
1124972004 15:34496741-34496763 GGGCTGAGATGCACCCCCTGGGG - Intergenic
1126437271 15:48648131-48648153 GGGCTGCTCTGCACCCACAGGGG + Intergenic
1127142706 15:55993676-55993698 GGGAGGCGCTGCTGTCGCTGAGG - Intronic
1127805064 15:62511602-62511624 GGACTCCGCTTCTCACGCTGGGG - Intronic
1127931665 15:63601057-63601079 GGGCTGCGCTCCTTCCCCGGGGG - Intronic
1128056541 15:64703454-64703476 GGGCCGCGCTGCCGCAGCTGCGG - Intergenic
1128830390 15:70763276-70763298 GGGCTGCGCTGCTCCCGGAGCGG + Intronic
1129914184 15:79253981-79254003 AGGCTGAGCTGCTCTCCCTGCGG - Intergenic
1130093420 15:80839499-80839521 CGGCTTCGCTGCTGCTGCTGCGG - Intronic
1131657721 15:94479005-94479027 GCGCTGCGCTTCTTCCGCAGGGG - Exonic
1132580022 16:680444-680466 GGGCTGCGGGGCTCCGGCTGCGG + Exonic
1134089478 16:11383956-11383978 GGGCAGGCCTGCTCCTGCTGAGG + Exonic
1134608470 16:15589555-15589577 GCGGTGCTCTGCTCCCTCTGTGG + Intronic
1136927188 16:34385540-34385562 GGGCTTCCCTGATCCAGCTGGGG - Intergenic
1136977386 16:35026267-35026289 GGGCTTCCCTGATCCAGCTGGGG + Intergenic
1137268072 16:46884778-46884800 CGGCCGCGCTGCTCTGGCTGCGG - Exonic
1137585976 16:49664287-49664309 AGGGTGTGCTGCTCCCGCGGCGG + Intronic
1142283754 16:89162578-89162600 AGGCTGCTCTGATCCTGCTGTGG - Intergenic
1142586717 17:979038-979060 GTGCTGCGCTGCGCCCGCCCTGG - Intronic
1142964271 17:3571226-3571248 GGGCTGGGCTGCGTCCCCTGGGG + Intronic
1143499203 17:7329219-7329241 GTCCTGAGCCGCTCCCGCTGGGG + Exonic
1146687241 17:34849311-34849333 GGGCTGCCCTGCTTCCTCTCCGG + Intergenic
1147541706 17:41365484-41365506 GGTGGACGCTGCTCCCGCTGTGG - Exonic
1148722503 17:49763953-49763975 GGGCTGGGCTGCAGCCGCTCAGG - Exonic
1150413421 17:64966154-64966176 GGGCCGCGTTGCTCCCTCTAGGG - Intergenic
1150798395 17:68259063-68259085 GGGCCGCGTTGCTCCCTCTTGGG + Intergenic
1151709272 17:75792081-75792103 GTGCTGTGCTGCTCAGGCTGTGG - Intronic
1152610004 17:81310727-81310749 GAGCTGCTGTCCTCCCGCTGGGG - Intergenic
1152636650 17:81432928-81432950 AGGCTGCGCTCCTCCCTGTGGGG + Intronic
1152896074 17:82912139-82912161 GGGCTGCTCTGTCCACGCTGGGG - Intronic
1153893104 18:9536321-9536343 GGTCAGCGCTGCGCCTGCTGTGG + Exonic
1154300126 18:13185093-13185115 AGGCTGCGCTGCCCTCACTGGGG + Intergenic
1157543530 18:48530917-48530939 GGGCTGCTGTGCTCCCTGTGGGG - Intergenic
1160455202 18:78994655-78994677 GGGCGGGGCTGCCCGCGCTGCGG - Exonic
1160966653 19:1749688-1749710 GGGCTCCGTTGCCCCCGCCGCGG - Intergenic
1161010007 19:1955431-1955453 GGGCTGCCCTTCACCGGCTGTGG + Intronic
1161504862 19:4638571-4638593 CGGCTGCGCAGCGCCAGCTGGGG - Intergenic
1161793144 19:6372828-6372850 GGACTGGGCTGCTGGCGCTGCGG + Exonic
1161988196 19:7669272-7669294 GGGCAGGGCTGATCCAGCTGTGG + Intronic
1162084367 19:8239561-8239583 GGGCTGCTCTGCTCCCACAGTGG - Intronic
1163358323 19:16829478-16829500 GGGCTGAGCGGCGCCCGCTGGGG + Exonic
1163818595 19:19483127-19483149 GGGCTCCTCTGCTCTAGCTGGGG + Intronic
1164647756 19:29872298-29872320 GGGCTGCACTGCCCCCGCTTGGG - Intergenic
1164885698 19:31776766-31776788 GGGCTGAGCTGCGGCTGCTGTGG + Intergenic
1165111554 19:33505405-33505427 GGGCAGCGCTGTTCCCTCTGTGG - Intronic
1165830590 19:38728504-38728526 CGGCTGCGCTGCTCGGGCGGAGG - Intronic
1167561656 19:50229595-50229617 GTGCTGCTGTGCTCCAGCTGAGG + Intronic
1168097241 19:54122817-54122839 GACCCACGCTGCTCCCGCTGTGG + Intronic
925317050 2:2934445-2934467 TGGCTGCCCTGCTCCTGCTCAGG + Intergenic
925413673 2:3655034-3655056 GGGCTACTCTCCTCCCTCTGCGG + Intergenic
926195210 2:10759573-10759595 GGTCTGCGTTGCCCCCTCTGAGG + Intronic
934300316 2:91772815-91772837 GTTCTGGGCTGCACCCGCTGGGG - Intergenic
934544960 2:95207196-95207218 GGGCTGCGGTGCTCCATCGGAGG - Intergenic
934933170 2:98445000-98445022 CGGCGGCGCTGCTGCTGCTGCGG + Exonic
935652999 2:105398593-105398615 GGGCTGCAGTCCTCCCTCTGGGG + Intronic
937886297 2:126901863-126901885 GGGCTGCCCTGTTCCTGCTGAGG - Exonic
943725179 2:191245517-191245539 GGGCTGCGGGGCTCCCGCCGCGG - Exonic
946354860 2:219178291-219178313 GGGCTGCGCGGCCGCCGCCGGGG - Exonic
946863019 2:224018100-224018122 GGGCTGAGCTGCTTCCCCTGGGG - Intronic
947736774 2:232459279-232459301 GGGCCCCGCTGCGCCAGCTGAGG - Exonic
1169195822 20:3681614-3681636 GGGCTGGGCTGCCCCCGAGGGGG + Intronic
1171109564 20:22467618-22467640 GGGCTGTGCTGTGCCCGCTGAGG + Intergenic
1175182204 20:57156555-57156577 GTTCTGCGCAGCTCCTGCTGGGG + Intergenic
1175256852 20:57652850-57652872 GAGCTGGGCTGCTCCCTCAGGGG + Intronic
1175256880 20:57652970-57652992 ACCCTGGGCTGCTCCCGCTGCGG - Intronic
1175881107 20:62259589-62259611 AGGCTGCGATGCGCCCGTTGTGG - Intronic
1176302856 21:5107021-5107043 GTGCTGCGCTCCTCTCGCTGGGG + Intergenic
1178500975 21:33125172-33125194 GGTCTGCGCTGCTGGCTCTGGGG - Intergenic
1179408450 21:41143964-41143986 GGGCAGAGCTGCTCCTCCTGAGG + Intergenic
1179535449 21:42048577-42048599 GGGCTGGTCTGCTTCCCCTGGGG + Intergenic
1179854168 21:44154902-44154924 GTGCTGCGCTCCTCTCGCTGGGG - Intergenic
1180089287 21:45525571-45525593 AGGCTCAGCTGCTCCCACTGAGG + Intronic
1181030314 22:20146282-20146304 TGGCTGCGGTGCTCGCGCCGTGG + Intronic
1181069161 22:20321590-20321612 GGCCTGGCCTGCTCCTGCTGTGG - Intergenic
1181121258 22:20669732-20669754 GGTCTGACCTGCTCCCGCAGGGG - Intergenic
1181335234 22:22124194-22124216 GAGCTGCGCTGCCCGCGGTGAGG + Intergenic
1181512979 22:23397091-23397113 TGGCTGCGGTGCTCACGCCGTGG - Intergenic
1181698670 22:24607948-24607970 GTTCTGGGCTGCACCCGCTGGGG - Exonic
1181924532 22:26347876-26347898 GGGGGTCGCTGCTCCAGCTGAGG - Exonic
1182115239 22:27752815-27752837 GGGGGGCTCTGCTCCAGCTGAGG + Intronic
1182222995 22:28773161-28773183 GGGCTGCGAAGCTCCCGCGGAGG - Intronic
1182285234 22:29243166-29243188 GGGCTGAGGTGCACCCTCTGAGG + Intronic
1182696934 22:32204302-32204324 TGGCTGCACTGGTCGCGCTGGGG - Intergenic
1183321983 22:37170485-37170507 GGGTGGCGCTGCTTCCCCTGTGG - Intronic
1183924668 22:41197412-41197434 GCGCCGCGCTCCTCCCGCTCTGG + Intergenic
1184361895 22:44024093-44024115 AGGCTGCGCCGCTCCCGGGGTGG + Intronic
1184461539 22:44640569-44640591 GGGCGGCGCTGCCACTGCTGAGG + Intergenic
1185116173 22:48939625-48939647 GGGCTGAGCTACTCCTGCTGGGG - Intergenic
1203280606 22_KI270734v1_random:128956-128978 GGCCTGGTCTGCTCCTGCTGTGG + Intergenic
950521761 3:13501697-13501719 GAGCTGTGCAGCTCCAGCTGTGG - Intronic
950634797 3:14307306-14307328 GCCCTGCCCTGCTCCCACTGAGG - Intergenic
951558699 3:23945520-23945542 CGGCGGCGCTGCCCCCTCTGCGG + Exonic
954277989 3:49554742-49554764 CGACCGCGCTGCTCCCGCCGCGG - Exonic
962051434 3:131819881-131819903 GGGCCCAGCTGCTCCCTCTGGGG + Intronic
966474231 3:180325449-180325471 GGTCAGCGCTGCACCTGCTGTGG + Intergenic
967294060 3:187948445-187948467 GGACTGAGATGCTCCCACTGAGG + Intergenic
968045818 3:195623526-195623548 GTGCTGCTCTGATGCCGCTGAGG + Intergenic
968308838 3:197666561-197666583 GTGCTGCTCTGATGCCGCTGAGG - Intergenic
968662979 4:1806446-1806468 GGGCTGCGCTGCTGCCCCCAGGG - Intronic
968954865 4:3713071-3713093 TGGCTGCGCTGGCCCCGCAGTGG - Intergenic
969114406 4:4862091-4862113 GGTCTGCGCTGCTCCATCTCTGG + Intronic
969712678 4:8853043-8853065 GGGCTGCCCACCTCCCACTGTGG + Intronic
972312103 4:37891222-37891244 TGGCTGCGCTCTTCCCGCCGCGG - Exonic
978154476 4:105473759-105473781 GGACCGCGCGGCTACCGCTGAGG + Intronic
982573187 4:157076084-157076106 GGCCCGCGCTGTCCCCGCTGCGG + Exonic
985531249 5:434894-434916 GGGCTGCCCTGCTCCTGGTCAGG + Exonic
985609830 5:881213-881235 GTGCTGCGCTGCCCCTCCTGAGG - Intronic
989750196 5:44884002-44884024 GGGCTGCGCGGAGCCCACTGGGG + Intergenic
995048170 5:107672464-107672486 AGCCAGCGCTGCTGCCGCTGCGG + Intergenic
995518448 5:112976902-112976924 GGGATGCACTGTTCCTGCTGTGG + Exonic
995759056 5:115544613-115544635 GGGCCGCCCTGCTCCGCCTGCGG + Exonic
997470872 5:134115990-134116012 GTGCTGCCCTGCTCCCGAGGGGG - Exonic
997583992 5:135034108-135034130 GCGCTGCGCTCCTGCCGCTCGGG + Exonic
997975410 5:138439065-138439087 GCGCTCCGCTGCCCCCGCGGCGG + Exonic
1001332468 5:170772074-170772096 GGGCTGAGCTGCACCAGCTCTGG - Intronic
1002029370 5:176416552-176416574 CGGCTCCGCTCCTCCCGCCGCGG - Exonic
1003492717 6:6637707-6637729 GGGCTGCGTTTCTCACACTGGGG - Intronic
1004814463 6:19297985-19298007 TGGCTGAGCTGCTCCAGGTGTGG - Intergenic
1005822035 6:29606414-29606436 GAGCTGCAATGCTCCAGCTGGGG + Exonic
1006787550 6:36678695-36678717 GCGCTGAGCTGCGCCAGCTGAGG + Exonic
1007072972 6:39049723-39049745 GGGCTGCGGTGGTCCACCTGTGG - Intronic
1007709120 6:43810512-43810534 GGGCTGTTCTGCTCCCACAGAGG + Intergenic
1007740266 6:44005495-44005517 GGGGGGCGCTGCTCCCAGTGGGG + Exonic
1017073756 6:150599936-150599958 GGGCTGCGCTGCGCCGGCTCGGG - Exonic
1017939100 6:159035938-159035960 GACCTGAGCTCCTCCCGCTGAGG - Exonic
1018275435 6:162125297-162125319 GGGCTGTGTTTCTCCCTCTGAGG - Intronic
1018945570 6:168345472-168345494 GGGCTGCGCCGCCTCCCCTGGGG + Intergenic
1019173018 6:170145442-170145464 GGGCTGCAGAGCGCCCGCTGGGG - Intergenic
1019696840 7:2450944-2450966 GGGCTGAGCTGCCACCCCTGCGG - Intergenic
1019709503 7:2511795-2511817 GGGCTGGGCTGCTCAGGCTGTGG - Intergenic
1019916886 7:4139099-4139121 GGGCTGGGCTCCTCCCACTGTGG - Intronic
1020139858 7:5606322-5606344 GGGCTGAGATGCACCCCCTGGGG - Exonic
1026000313 7:66556157-66556179 GGGCTGGGCTGGCCCCGCCGTGG + Intergenic
1032011836 7:128352134-128352156 TGGCTGCGCTGCTGCTCCTGGGG - Exonic
1032215317 7:129952771-129952793 GGGCTGCCCCTCTCCGGCTGTGG + Exonic
1034689707 7:153004483-153004505 GGGCAGCTCTGCTGCCACTGAGG + Intergenic
1035390446 7:158500911-158500933 GGGCCGCGCTCCTCACGCGGCGG + Intronic
1035546918 8:488729-488751 GGGCTACTCTGTTTCCGCTGGGG + Intergenic
1037152363 8:15653229-15653251 GAGCTGCGCCTCTCCCACTGAGG - Intronic
1037913760 8:22759536-22759558 GGGCTGCGGGGCTGCAGCTGGGG + Intronic
1045314005 8:101027601-101027623 GGGCTGGGCAGCTCCTGTTGGGG + Intergenic
1048996900 8:139800131-139800153 AGACTGCGCTCCTGCCGCTGGGG + Intronic
1049386499 8:142345471-142345493 GAGCAGGGGTGCTCCCGCTGGGG - Intronic
1057371632 9:94479580-94479602 GGGCTGCGCTGCCCACAGTGGGG + Intergenic
1057489187 9:95508541-95508563 GGCGGGCGCTGCTGCCGCTGCGG + Exonic
1060812710 9:126619034-126619056 GGGCTCCGCCGGGCCCGCTGGGG + Intronic
1061782550 9:133004464-133004486 GGGCTGCACTGCTGCAGGTGTGG + Intergenic
1061801757 9:133116627-133116649 GGGCTGCCCTGCACCCCCTTGGG - Intronic
1062049725 9:134441033-134441055 GGGCTGGGCTGCTCCCGGCCTGG + Intergenic
1062271981 9:135713993-135714015 GAGCTGAGCTGCTCCGCCTGGGG + Intronic
1062571666 9:137188672-137188694 GGACAGCGCTGCTTCCGCGGCGG + Exonic
1186496480 X:10015660-10015682 CGGCGGCGCGGTTCCCGCTGGGG - Exonic