ID: 901631090

View in Genome Browser
Species Human (GRCh38)
Location 1:10648486-10648508
Sequence TTCACAGCAGGCTTCCCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901631083_901631090 22 Left 901631083 1:10648441-10648463 CCTTCCAGAACCTGCTCGGAGGT 0: 1
1: 0
2: 2
3: 7
4: 101
Right 901631090 1:10648486-10648508 TTCACAGCAGGCTTCCCCGCGGG 0: 1
1: 0
2: 0
3: 14
4: 138
901631086_901631090 12 Left 901631086 1:10648451-10648473 CCTGCTCGGAGGTCTTAAAGGTA 0: 1
1: 0
2: 0
3: 2
4: 51
Right 901631090 1:10648486-10648508 TTCACAGCAGGCTTCCCCGCGGG 0: 1
1: 0
2: 0
3: 14
4: 138
901631084_901631090 18 Left 901631084 1:10648445-10648467 CCAGAACCTGCTCGGAGGTCTTA 0: 1
1: 0
2: 2
3: 7
4: 57
Right 901631090 1:10648486-10648508 TTCACAGCAGGCTTCCCCGCGGG 0: 1
1: 0
2: 0
3: 14
4: 138
901631080_901631090 28 Left 901631080 1:10648435-10648457 CCTCTTCCTTCCAGAACCTGCTC 0: 1
1: 0
2: 4
3: 47
4: 506
Right 901631090 1:10648486-10648508 TTCACAGCAGGCTTCCCCGCGGG 0: 1
1: 0
2: 0
3: 14
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901631090 Original CRISPR TTCACAGCAGGCTTCCCCGC GGG Intronic
900756034 1:4435423-4435445 TTCACAGCAGCATTACCCACAGG - Intergenic
901631090 1:10648486-10648508 TTCACAGCAGGCTTCCCCGCGGG + Intronic
913094847 1:115506755-115506777 GTCACAGGTGGCTTCCCCGGAGG - Intergenic
917527532 1:175802228-175802250 GTCACAGGCAGCTTCCCCGCTGG - Intergenic
923012493 1:230099554-230099576 CTCAAACCAGGCTTCCCAGCTGG - Intronic
923985744 1:239379863-239379885 ATGACAGCTGGCTTCCCCTCTGG - Intergenic
1065226286 10:23546859-23546881 TTCACTGCAAGCTTCACCTCTGG + Intergenic
1066080861 10:31929024-31929046 TTGACCGCAGGCTCCCGCGCCGG - Intergenic
1071055705 10:81505991-81506013 TTCTCACCAGGCCTCCCCGCGGG + Intergenic
1071089195 10:81899214-81899236 TGCACAGCATGGTTCCCCACTGG - Intronic
1071872220 10:89808253-89808275 CTCACTGCAGCCTTCCCCTCAGG - Intergenic
1073477890 10:103766275-103766297 TTCACAGTGGGCTTCCCCCCGGG - Intronic
1074404836 10:113171950-113171972 TTCACGGCAGGCCTCTCCGATGG - Intergenic
1075442996 10:122494290-122494312 TTCACAGCTGTCTGCCCCGGAGG + Intronic
1076212584 10:128660302-128660324 TCTACAGCAGGCTTCCCAACTGG + Intergenic
1076499077 10:130921633-130921655 ATGACAGCAGGCTTCCCCCGGGG - Intergenic
1076499089 10:130921679-130921701 ATGACAGTAGGCTTCCCCGGGGG - Intergenic
1076677448 10:132154472-132154494 TTCAGAACTGGGTTCCCCGCTGG + Intronic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1077772422 11:5234396-5234418 TTGACAGCAGTCTTCTCCTCAGG + Exonic
1078852573 11:15178161-15178183 TCCACAGCTGGCTTGCCCACTGG - Intronic
1079284507 11:19117023-19117045 TTCACAGCGGGCTTCCCAGGAGG + Intergenic
1080740081 11:35055724-35055746 TTCATAAGGGGCTTCCCCGCTGG + Intergenic
1081248415 11:40798387-40798409 TTCTCAGCAAGCTTCCCCTATGG - Intronic
1082179621 11:49102371-49102393 TTCCCAGCTGGCTGCCACGCAGG - Intergenic
1083768324 11:64852944-64852966 TTCCCACCAGGCTTTCCCGCGGG - Exonic
1086685662 11:89730547-89730569 TTCCCAGCTGGCTGCCACGCAGG + Intergenic
1086700540 11:89896645-89896667 TTCCCAGCCGGCTGCCCCACAGG - Intergenic
1086705629 11:89947881-89947903 TTCCCAGCCGGCTGCCCCACAGG + Intergenic
1090976116 11:131682290-131682312 CTCACAGCAGCCTTCCAGGCAGG - Intronic
1096113034 12:49040268-49040290 TTCCCAGCAGCCCTGCCCGCGGG - Exonic
1096375516 12:51106776-51106798 TTCTCAGCAGGCCTCCCCACAGG - Intronic
1097907424 12:64934534-64934556 GTCACAGCAGGCTTCTCTGAGGG - Intergenic
1104707112 12:130955653-130955675 CTCACAACAGGCTTCCCAGCAGG - Intronic
1106413674 13:29528263-29528285 TTCTCAACAGGCTTCCATGCAGG + Intronic
1106514088 13:30438055-30438077 TTCACTGCAGCCTTCACCTCAGG + Intergenic
1107448168 13:40486383-40486405 TTCACTGCAGGTTTCATCGCAGG - Intergenic
1113080532 13:106515069-106515091 TTCACAGGAGGTTTCCTCCCAGG + Intronic
1113946353 13:114046367-114046389 TGCACAGCAGGACTCCCCACGGG + Intronic
1117745607 14:58866394-58866416 ACCACAGCAGGTTTCCCAGCAGG - Intergenic
1118004048 14:61549334-61549356 TTCACAGCAGGCCTCGCTGAGGG - Intronic
1122722321 14:103729158-103729180 CTCACAGAAGGCTTCCCTCCTGG + Exonic
1126777002 15:52109041-52109063 TTGACAGCATGATTCCCTGCAGG - Intergenic
1130569619 15:85029932-85029954 TCCCCAGCGGGCTTCCCCTCAGG + Intronic
1132219994 15:100098241-100098263 ATCACAGCTGGCTTCCCTCCAGG - Intronic
1133810081 16:9154920-9154942 TTCTGAGCCCGCTTCCCCGCAGG + Intergenic
1134044595 16:11091950-11091972 TCCTCAGAAGGCTTCCCCGTCGG + Intronic
1137734179 16:50711928-50711950 ATCACAGCAGCCTTCCTGGCAGG + Exonic
1141959543 16:87395404-87395426 TTCTCAACAGACTGCCCCGCTGG - Intronic
1147381730 17:40060286-40060308 TTCAAAGCAGGCCTCTCCCCAGG - Intronic
1147805478 17:43127725-43127747 ATAAAAGCAGGCTGCCCCGCTGG + Intergenic
1148383288 17:47216364-47216386 TGCATACCAGGCTTCCCAGCAGG + Intronic
1151599614 17:75098160-75098182 TTCACAGCAGGATTCATCACAGG + Exonic
1152821761 17:82441143-82441165 TTCTCAGCAGGGCTCTCCGCAGG + Exonic
1152902076 17:82948127-82948149 TTCTCATCAGGGTTCCCCACCGG - Intronic
1154294329 18:13136183-13136205 TTAAAAGCAAGCGTCCCCGCGGG + Intergenic
1154300056 18:13184767-13184789 TGCACACCAGGCTTGCCCTCAGG - Intergenic
1155165962 18:23232710-23232732 TCCACAGCAGGCTTCCTGGGAGG - Intronic
1155268679 18:24118454-24118476 TTCACCACACGCTTCCCCTCTGG + Intronic
1157869360 18:51215806-51215828 CTCACTGCAGCCTTCCCCTCGGG + Intronic
1159072483 18:63641249-63641271 TGCAGAGCAGGCTTCCCTGAAGG + Intronic
1159073926 18:63658888-63658910 TGCAGAGCAGGCTTCCCTGAAGG + Intronic
1160437064 18:78859847-78859869 CTCACAGCTCTCTTCCCCGCTGG - Intergenic
1162795073 19:13082795-13082817 CTCGCAGCAGGCTTCCAAGCTGG - Intronic
1164416012 19:28047011-28047033 TTCACAGCTGTCTTCACCGGGGG + Intergenic
1164744581 19:30601715-30601737 TTGACAGCAGGCTTCTCGGCTGG - Intronic
1165678900 19:37756027-37756049 TTCCCTGCAGGCTTCCCTGAAGG - Intronic
1166055069 19:40283758-40283780 TTCAGAGCAGCCTTCCTCCCTGG + Intronic
927181413 2:20448735-20448757 TTCGCAGCGGGCTGGCCCGCAGG - Exonic
930138884 2:47931663-47931685 TTCACAGAAGGGTTCCCGGCCGG + Intergenic
931426450 2:62176239-62176261 TTCAAAGCAGGTTTCCCACCAGG - Intergenic
933791276 2:85885749-85885771 TTCACTGCAGGCTCCGCCTCCGG - Intronic
935537931 2:104316254-104316276 GTCACAGCTGACTTCCTCGCTGG + Intergenic
936253329 2:110886323-110886345 GTCACAGCATTCTTCCCCACTGG + Intronic
936987219 2:118323099-118323121 ATCACAGCAGGTTTTCCCTCAGG + Intergenic
937267754 2:120627456-120627478 TTCCCAGCAGCCTTTCCCGATGG - Intergenic
937297881 2:120820597-120820619 TGGACAGCAGCCGTCCCCGCAGG - Intronic
937507855 2:122557021-122557043 CTCACTGCAGGCTCCCCCACCGG - Intergenic
937808479 2:126172894-126172916 TGCACACCAGCCTTCCCTGCTGG + Intergenic
938131182 2:128716698-128716720 TTCACAGCAGGCAGCCTCGCGGG - Intergenic
941080742 2:161057875-161057897 TTCACAGCAGCCTCCTCTGCTGG - Intergenic
941863782 2:170312616-170312638 TTCCCACCAGCCTTCCACGCAGG - Intronic
945097101 2:206230445-206230467 TTCACAGCAGGGATCCCTGCTGG + Intergenic
948173817 2:235928017-235928039 TACACAGCAGGTGTCCCTGCAGG + Intronic
1170985166 20:21251319-21251341 ACCACAGAGGGCTTCCCCGCAGG - Intergenic
1172642105 20:36446734-36446756 TTCACTGCAGGCTGACTCGCAGG - Exonic
1172642228 20:36447312-36447334 CTCACTGCAGGCTTCTCTGCAGG - Intronic
1173026232 20:39310032-39310054 TTCATAGAAGGCTTCCTGGCAGG - Intergenic
1173943967 20:46935220-46935242 TTCCCAGCAGGCTGCCCTGGTGG - Intronic
1173964046 20:47098442-47098464 TTCACAGCAGGCTGCCTCTAAGG - Intronic
1174062452 20:47842565-47842587 TTCACTGCAGACTTCCTCGAAGG - Intergenic
1174419618 20:50391104-50391126 GGGACAGCAGGCTTCCCCGAGGG - Intergenic
1177677317 21:24317346-24317368 TGCAGAGCAGGCTGCCCCGTAGG + Intergenic
1181463851 22:23100365-23100387 GTCACAGCAGGGTTCACCGTGGG + Intronic
1183003499 22:34880855-34880877 TGCACAGCAGGGTTGCCAGCTGG - Intergenic
1184092026 22:42297866-42297888 TTCACAGCAGGGCTCCTCTCTGG + Intronic
1184410201 22:44321907-44321929 TTCACAGCAGGCCCTCCTGCAGG - Intergenic
952278046 3:31896679-31896701 TTCACAGCAGCCCTTCCAGCTGG - Intronic
952400026 3:32954716-32954738 CTCACACCAGGCTTGCCTGCAGG + Exonic
952548426 3:34448726-34448748 ATAACAGCAGACTTCCCAGCAGG - Intergenic
958659208 3:97043571-97043593 TTCAAAGCAGGCTCCACAGCTGG + Intronic
962146242 3:132842969-132842991 GTCAGAGAAGGCTTCCCCGGTGG + Intergenic
962712723 3:138101404-138101426 TGCACAGCAGCCTCCCCCGCTGG + Intronic
964670043 3:159214932-159214954 TTAACAGCAGACTTCCCATCAGG - Intronic
968061970 3:195732654-195732676 TTCAAAACTGGCTTCCCGGCCGG - Intronic
969282694 4:6181814-6181836 TTCACAGTCTTCTTCCCCGCTGG - Intronic
969511040 4:7618150-7618172 TTCACAGAAGCCTCCTCCGCAGG + Intronic
970493569 4:16602259-16602281 TTCACGGCAGCCTTCCAGGCTGG - Intronic
970597614 4:17614601-17614623 TTCTGAGCCGGCTTCCGCGCAGG + Intergenic
977454797 4:97245580-97245602 TTCTCAGTAGGCTTCCAAGCGGG - Intronic
985156845 4:186998553-186998575 TTCTCAGCAGGCCTCCTCGCTGG - Intergenic
986048773 5:4067277-4067299 TGCACACCTGGCTTCCCCGCTGG - Intergenic
987305309 5:16632025-16632047 TACACATCAGGCTTGCCCTCAGG - Intergenic
989523271 5:42424817-42424839 GTCTCAGCAGGCATCCCCTCGGG - Intronic
991976255 5:72186287-72186309 TTCAAAGCAGTCTTCACAGCTGG - Intronic
992113060 5:73514214-73514236 ATCACAGCTGGCTTCCCACCAGG - Intergenic
994398064 5:99243749-99243771 TTCACAGCAGCATTCCCCAATGG + Intergenic
995879604 5:116829723-116829745 TTCACTGCATGCTTTCCCACAGG + Intergenic
999251504 5:150185064-150185086 TGCATAGCAGTCTTCCCCACTGG - Intergenic
1001084017 5:168687256-168687278 TCCACAGCAGGTTTCCCTGGTGG + Intronic
1002333966 5:178465499-178465521 TGCACAGCAGGCTTGCTCGGAGG - Intronic
1005379122 6:25216072-25216094 CTCACTGCAGCCTTCCCCTCAGG + Intergenic
1016384522 6:143517356-143517378 ATCACAGCAGGCATGCCAGCAGG + Intergenic
1017958344 6:159198954-159198976 ATCACAGCAGGCATCCCAGGGGG + Intronic
1019255356 7:46367-46389 TTCACAGCAGGACTCCCTGGAGG - Intergenic
1019344018 7:520905-520927 TGCACAGCACGCCACCCCGCTGG - Intergenic
1019559429 7:1648570-1648592 TCCACAGCAGGCTGCACCCCCGG + Intergenic
1019983290 7:4637587-4637609 TTCACAGTGGTCTTCACCGCTGG - Intergenic
1024959586 7:54960275-54960297 TCCAAAGCTGGCTTCCACGCAGG + Intergenic
1025231991 7:57208573-57208595 TTCACTGCAGACTTCCTCGAAGG + Intergenic
1026497904 7:70919482-70919504 CTCATAGCAGCCTTCCCCGTGGG + Intergenic
1033066672 7:138161997-138162019 TTCACAGCAGGCTTTCTCTAGGG + Intergenic
1034398668 7:150846978-150847000 TTCACAGCAGACCTCCTCACTGG - Intronic
1034895677 7:154875024-154875046 TTCACTGCAGGCTTGACCTCTGG - Intronic
1035951195 8:4023202-4023224 TTCACATCTGGCTTCCCTGAAGG - Intronic
1037041107 8:14235552-14235574 TTCACTGCATGCTTTCCTGCAGG - Intronic
1043955180 8:86351410-86351432 TTCATAGCAGGCTTGACCTCGGG + Intronic
1044863557 8:96546940-96546962 TTCACAGCAGGATGCTCTGCTGG - Intronic
1045671445 8:104558134-104558156 TTCACTGCAGCCTTCGCCTCTGG - Intronic
1046766221 8:118073288-118073310 TCCACAGCATGCTTCACCGATGG - Intronic
1047404420 8:124573320-124573342 TTCACAGCAGGATTCCCTGAAGG - Intronic
1047842546 8:128768538-128768560 TTAACAGCAGGTTTCTCAGCAGG + Intergenic
1052585367 9:30421398-30421420 TTCACAGCAGGCCTGCAAGCTGG - Intergenic
1053122093 9:35555226-35555248 TACACAGCAGCCTGCCCCACTGG + Exonic
1057836429 9:98449145-98449167 TGCACAGGAGGGTTCCCCACAGG + Intronic
1062160080 9:135075248-135075270 GTCCCAGCCTGCTTCCCCGCCGG + Intergenic
1062327416 9:136018812-136018834 ATCACAGCAGGCTGCACCGGGGG - Intronic
1062422062 9:136487425-136487447 TCCACACCAGGCCTCCCCGGAGG + Intergenic
1188971229 X:36617894-36617916 TTCACAGAATGCTTCCCTGAGGG + Intergenic
1190822524 X:53986850-53986872 TTCACAGCAGTCTTGACCTCCGG - Intronic
1194241666 X:91457055-91457077 TTCACAGTAGTCTTGCCCTCAGG + Intergenic
1194335737 X:92644109-92644131 TTCACAGTAGTCTTGCCCTCAGG - Intergenic
1200736456 Y:6802890-6802912 TTCATGACAGGCTTCCCTGCAGG + Intergenic