ID: 901631500

View in Genome Browser
Species Human (GRCh38)
Location 1:10650337-10650359
Sequence GTTTAAAAGGGGATGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 631
Summary {0: 1, 1: 0, 2: 6, 3: 64, 4: 560}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901631500_901631509 23 Left 901631500 1:10650337-10650359 CCCTCCCCCATCCCCTTTTAAAC 0: 1
1: 0
2: 6
3: 64
4: 560
Right 901631509 1:10650383-10650405 AATAAATAAAATTAATAACGAGG 0: 1
1: 2
2: 17
3: 167
4: 1673

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901631500 Original CRISPR GTTTAAAAGGGGATGGGGGA GGG (reversed) Intronic
900278302 1:1847778-1847800 TTTTAAAAGGGTAGGGGGGTGGG + Intronic
901285719 1:8077126-8077148 TTTTAGCAGGGGTTGGGGGAGGG + Intergenic
901631500 1:10650337-10650359 GTTTAAAAGGGGATGGGGGAGGG - Intronic
901913772 1:12481650-12481672 CTTTCAAGGGGGATGGGGAAAGG + Intronic
902665522 1:17935059-17935081 TTTTAAAAAGGGAAGTGGGAGGG - Intergenic
902805752 1:18860379-18860401 GTGTCAAAGAGGGTGGGGGAAGG + Intronic
903283716 1:22264474-22264496 GTGAAAAAGGGGTTGGGGGAGGG - Intergenic
903532493 1:24042301-24042323 GTTTACAAGGGGATGTGAGTGGG - Intergenic
903646609 1:24899942-24899964 TTTTGTCAGGGGATGGGGGATGG + Exonic
903971040 1:27118974-27118996 TTTTAGAAGAGGCTGGGGGATGG + Intronic
905941658 1:41867923-41867945 TTTTGGAAGGGGAGGGGGGAGGG - Intronic
905946606 1:41906513-41906535 TTTTGCAAGGGGATGGGGGTAGG + Intronic
906558948 1:46739754-46739776 GTTTACCAGGGGATGGGAAAGGG - Intergenic
906647939 1:47489648-47489670 GTTTAGAGATGGATGGGGGATGG + Intergenic
907243672 1:53094070-53094092 TTTGCAAAGGGGATCGGGGATGG - Intronic
907911774 1:58833584-58833606 GTTTCATAGGGGATCAGGGAGGG - Intergenic
908123192 1:61004973-61004995 GTTGGAAAGGGGCTGAGGGAGGG - Intronic
911440963 1:97925290-97925312 GTTTTGAATGGGTTGGGGGATGG - Intergenic
911721011 1:101191156-101191178 GGTTAAAAGTGTATGGGGGCAGG + Intergenic
912079386 1:105915988-105916010 GTTTTAAAAGGAACGGGGGATGG - Intergenic
912192383 1:107354674-107354696 GACCAAAAGGGGATGGGAGAGGG - Intronic
913069485 1:115286033-115286055 GTGTAGAAGGGGCAGGGGGAGGG + Exonic
913323714 1:117607781-117607803 GTGGAAAAGGGGGAGGGGGATGG + Intronic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
913702486 1:121386123-121386145 GTATGAAGGGGGATGAGGGAGGG + Intronic
913720837 1:121592706-121592728 GGTTACTAGGGGATGGGGGAGGG + Intergenic
914006327 1:143735737-143735759 GTTAAGAATCGGATGGGGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914043049 1:144066618-144066640 GTATGAAGGGGGATGAGGGAGGG + Intergenic
914135037 1:144893870-144893892 GTATGAAGGGGGATGAGGGAGGG - Intronic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914857730 1:151364709-151364731 GTGGAAAAGGGAATGGGGTAAGG + Intronic
915437160 1:155916098-155916120 TTTATAAAGGGGCTGGGGGAAGG - Intronic
915713502 1:157923212-157923234 TTTTTAAAGTGGCTGGGGGAGGG + Intergenic
916070188 1:161165538-161165560 TTTTAATCGGGGAGGGGGGAGGG + Exonic
916779268 1:168007474-168007496 GTTGAAAAGCAGATGGGGGTTGG - Intronic
917745770 1:178005536-178005558 GATGAAATGGGGTTGGGGGAAGG + Intergenic
918093744 1:181318026-181318048 TTTTAAAAGGGGAAAGGGGTGGG - Intergenic
918130106 1:181619880-181619902 GTTTTATTGGGGAGGGGGGAAGG + Intronic
918389598 1:184044732-184044754 GTTGCCAAGGGGATGGGGGTAGG + Intergenic
919468312 1:197948748-197948770 TTTTAAAAGGGGAGTTGGGAAGG - Intergenic
919816352 1:201443111-201443133 GTAGAATAGGGGCTGGGGGAGGG + Intergenic
919868729 1:201804039-201804061 GTATAGAAGGGAATGGGGGGTGG - Intronic
920082038 1:203381953-203381975 GTTTAAGTGGGGATGGGGGTGGG - Intergenic
920146748 1:203867845-203867867 GTTTTGCTGGGGATGGGGGAAGG + Intronic
920187061 1:204166345-204166367 GTATAAAAGGGGAAGGGCTAAGG - Intergenic
920365743 1:205447567-205447589 ATTTAAAAGGGGGCAGGGGAAGG + Intronic
920489915 1:206404866-206404888 GTATGAAGGGGGATGAGGGAGGG + Intronic
921176766 1:212602187-212602209 GCTGAAAAGGGGATGGTGTAGGG - Intronic
921330457 1:214030534-214030556 TTTTTAAAGGGGATTGAGGAGGG + Intronic
921501457 1:215909271-215909293 GTTTGCCAGGGGTTGGGGGAGGG + Intronic
921809637 1:219497907-219497929 GTTTAAAGTGGGATGGTGGATGG - Intergenic
922934278 1:229411486-229411508 GCTGGAAAGGGGAGGGGGGAGGG - Intergenic
923103919 1:230839456-230839478 GGTAAAAAGCGGAGGGGGGAGGG + Exonic
923465476 1:234244364-234244386 GGTAGAAAGGGGTTGGGGGAAGG + Intronic
1063464786 10:6236098-6236120 GTTTAAAAGGGCGCGGGGAAGGG - Intergenic
1064530844 10:16308218-16308240 GTTTACTAGGGGATGAGAGAAGG + Intergenic
1064756073 10:18572758-18572780 GTTTGAAATGGAATGGGGAATGG - Intronic
1065294719 10:24263334-24263356 GTTTCATGGGGGCTGGGGGAAGG + Intronic
1065786554 10:29221053-29221075 GGTTACCAGGGGTTGGGGGAGGG - Intergenic
1065875686 10:29995516-29995538 GCTTGAAAGCAGATGGGGGATGG + Intergenic
1066748315 10:38625604-38625626 GTTTAAATGGGGATTAAGGATGG + Intergenic
1066968367 10:42292171-42292193 GTTTAAATGGGGATTAAGGATGG - Intergenic
1066995655 10:42560416-42560438 GTTGGAAAGCAGATGGGGGAGGG - Intergenic
1067232858 10:44424381-44424403 GTTTAACGAAGGATGGGGGAAGG + Intergenic
1067254084 10:44618119-44618141 GGTTATCAGGGGATGGGTGAAGG + Intergenic
1067546210 10:47194403-47194425 GTTTAAAAAGGGGCGGGGCATGG - Intergenic
1067687692 10:48477113-48477135 GGTTAAGATGGGATGGGAGAGGG - Intronic
1068059638 10:52051191-52051213 TTTTAAAAGGAGATGGATGAGGG + Intronic
1068960340 10:62860972-62860994 GTTGGATTGGGGATGGGGGATGG + Intronic
1069202462 10:65638128-65638150 AGAGAAAAGGGGATGGGGGATGG - Intergenic
1069617233 10:69813901-69813923 GGATAAATGGGCATGGGGGAGGG - Intronic
1069840147 10:71334755-71334777 GTATGAATGGGGATGGGGGGAGG - Intronic
1070066009 10:73035203-73035225 GTTTAAAAGGCAGTGAGGGATGG - Intronic
1070186478 10:74067813-74067835 GGTTATCAGGGGACGGGGGAAGG + Intronic
1070605235 10:77893806-77893828 GATCAATGGGGGATGGGGGAAGG + Intronic
1070666747 10:78350435-78350457 GTTTAAGGTGTGATGGGGGAGGG - Intergenic
1070835467 10:79444899-79444921 GCTCCAAAGGGGTTGGGGGAGGG - Intronic
1071991305 10:91103108-91103130 GATTGAAAGGGCATGGAGGAAGG + Intergenic
1072093446 10:92152495-92152517 GTTTAAAAGGGGAAGGTGGAAGG - Intronic
1072827581 10:98623328-98623350 GTTTAAGATGGGAGGGGGAAAGG + Intronic
1073128092 10:101164940-101164962 GGTTACAAGGGGCTGGGGGTGGG - Intergenic
1073759348 10:106612995-106613017 AATTAAAATGTGATGGGGGAGGG - Intronic
1074394937 10:113089737-113089759 GTTTACAAGGAGAGGGTGGAGGG + Intronic
1074403054 10:113157700-113157722 CCATAAAAGGGAATGGGGGACGG - Intronic
1074834088 10:117272528-117272550 GTTTAAATGGGGAAAGAGGAGGG - Intronic
1075547280 10:123364385-123364407 GGTTAAATGGGGTTGGGGGGAGG + Intergenic
1077726328 11:4678675-4678697 GGTTACCAGGGGCTGGGGGAGGG - Intergenic
1077919270 11:6630905-6630927 GTGTAAAAGGGGATCTGGGCTGG + Intronic
1079371612 11:19858217-19858239 GTTTACCAGGGGCTGGTGGATGG - Intronic
1079483472 11:20909156-20909178 GGTTAACAGGGGATGGTGGCGGG + Intronic
1080266700 11:30408662-30408684 GATTAAAAGGGCATGGGCTATGG + Intronic
1080741194 11:35065951-35065973 ATGGAAAAGGGGATGGGGCAAGG - Intergenic
1080742013 11:35074727-35074749 GGTTACATGGGGATGGGGTAGGG + Intergenic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1081869735 11:46377837-46377859 GATTCGAAGGGGATGGGGGTGGG - Intronic
1083066963 11:59934164-59934186 GTTTACGAGGGGATGGGGACAGG - Intergenic
1083468410 11:62864892-62864914 GTTTAAACGGGGACTGGGCATGG - Intronic
1083732881 11:64662484-64662506 GTTTAAAAGGGGTCGGGGCCGGG + Intronic
1084213348 11:67633984-67634006 GTGGAAAAGGGGGTGGGGGCGGG - Intronic
1084288724 11:68148123-68148145 GTTTAAAAGGGGATGATAGCTGG - Intergenic
1084447441 11:69212104-69212126 GTTTAAATTGGGTTGGGGGACGG - Intergenic
1084462572 11:69304058-69304080 GTTGAGAAGGGACTGGGGGATGG + Intronic
1084728189 11:71055763-71055785 GTTTTCTAGGGGCTGGGGGAGGG + Intronic
1085483401 11:76841579-76841601 GTGAGAAAGGGGATGGGGAAAGG - Intergenic
1085907540 11:80782450-80782472 GGTTAAAAGGGGCTGGGGCGGGG - Intergenic
1087429785 11:98038365-98038387 GTGCACAAGGGGAAGGGGGAAGG + Intergenic
1087698326 11:101406939-101406961 GCTTAAAAGGGGAGGGGGGCTGG + Intergenic
1088324292 11:108586439-108586461 GGAGGAAAGGGGATGGGGGAGGG - Intronic
1088324302 11:108586460-108586482 GGAGGAAAGGGGATGGGGGAGGG - Intronic
1088324312 11:108586481-108586503 GGAGGAAAGGGGATGGGGGAGGG - Intronic
1088324329 11:108586522-108586544 GGAGGAAAGGGGATGGGGGAGGG - Intronic
1088324339 11:108586543-108586565 GGAGGAAAGGGGATGGGGGAGGG - Intronic
1088324360 11:108586585-108586607 GGAGGAAAGGGGATGGGGGAGGG - Intronic
1088324377 11:108586626-108586648 GGAGGAAAGGGGATGGGGGAGGG - Intronic
1088324387 11:108586647-108586669 GGAGGAAAGGGGATGGGGGAGGG - Intronic
1088588012 11:111377072-111377094 TTTTTAAAGGGGATGCTGGAGGG - Intronic
1088804118 11:113335583-113335605 GTTGAGATGGGGTTGGGGGAAGG - Intronic
1089089665 11:115860442-115860464 GTTTTAAAAGGGATGGAGGAAGG + Intergenic
1089895825 11:121929183-121929205 AATTAAAAGGGAGTGGGGGAGGG - Intergenic
1090089339 11:123680866-123680888 GTTTGCCAGGGGCTGGGGGATGG - Intergenic
1091669190 12:2440286-2440308 GGTTACGAGGGGCTGGGGGAAGG - Intronic
1091693607 12:2613089-2613111 GATTAATTGGGGGTGGGGGAGGG + Intronic
1092439439 12:8485288-8485310 GTTTTACATGGGGTGGGGGAGGG + Intergenic
1092719668 12:11428995-11429017 GTTTTAAAAGAGATCGGGGAGGG + Intronic
1092749028 12:11701293-11701315 GATTACCAGGGGCTGGGGGAGGG - Intronic
1093417189 12:18933449-18933471 CTTTAAAAGGGTAAGGCGGAGGG - Intergenic
1093944423 12:25091264-25091286 GGTTACCAGGGGATGGGGTAAGG - Intronic
1093956693 12:25228591-25228613 GATTACCAGGGGCTGGGGGAGGG + Intronic
1094360904 12:29629648-29629670 GGTTATCAGGGGATGGAGGAGGG + Intronic
1096462929 12:51832583-51832605 GTTTAGAAGGGAGTGGGTGATGG - Intergenic
1096569124 12:52509856-52509878 CTATCAAAGGGGTTGGGGGAAGG - Intergenic
1096647289 12:53045815-53045837 GATGAAAAGGGGCGGGGGGAAGG - Intergenic
1096914765 12:55019792-55019814 GTTTAAATAGAGATGGGGGTTGG - Intergenic
1097176173 12:57144507-57144529 GTTTTAGAGGGGTCGGGGGACGG - Intronic
1097247789 12:57616110-57616132 GTGGAAAAGGGGATGGGCCATGG - Intronic
1097299703 12:58005001-58005023 ATTAAAAAAGGGATGGGGAAGGG + Intergenic
1097416524 12:59322954-59322976 GTCTGCAGGGGGATGGGGGAGGG - Intergenic
1097923672 12:65104985-65105007 GATTTAAAGGGGATGGGAGCTGG + Intronic
1098549721 12:71749898-71749920 GATTTAATGGGGGTGGGGGATGG + Intergenic
1098915199 12:76250072-76250094 GGTTTTAGGGGGATGGGGGAGGG + Intergenic
1099099868 12:78425349-78425371 ATTAAGAAGGGGATGAGGGAGGG + Intergenic
1100627741 12:96353592-96353614 GTTTAAAAGGTGGCGGGGGGGGG + Intronic
1101549292 12:105747231-105747253 GCTTTAAAGGTGGTGGGGGAAGG + Intergenic
1102210361 12:111122440-111122462 ATATAAAACGGGACGGGGGAGGG + Intronic
1102678936 12:114677074-114677096 CTTTGAAAGGGGGTGGGGGAGGG + Intronic
1103934038 12:124466013-124466035 GTTTATGAGTGGGTGGGGGAAGG - Intronic
1103977655 12:124713966-124713988 GCTTACCAGGGGCTGGGGGACGG + Intergenic
1106035388 13:26039690-26039712 CTTTAAAAGGGGATTGGTGTGGG - Intergenic
1107146731 13:37068604-37068626 GTTTACTAGGGGATATGGGAAGG + Intergenic
1107158134 13:37193685-37193707 ATGGAAAAGGGCATGGGGGATGG + Intergenic
1108203491 13:48064706-48064728 GTTTCCAAAGGGATGGGGGAGGG - Intronic
1108409352 13:50131153-50131175 GCTTTAAAAGGGATGGGGGATGG - Intronic
1108653221 13:52502750-52502772 TTTCAAAAGGGGAGGGGGGTAGG - Intergenic
1108744677 13:53379998-53380020 GATTGCCAGGGGATGGGGGAAGG - Intergenic
1109309111 13:60671767-60671789 CTTTGCATGGGGATGGGGGATGG + Intergenic
1110088959 13:71420664-71420686 GGTTACCAGGGGATGGGGAATGG - Intergenic
1110386605 13:74919563-74919585 TTTTAAAAAGGAATGGGAGATGG + Intergenic
1110542036 13:76717722-76717744 ATATAAATGGGGTTGGGGGAGGG - Intergenic
1110938310 13:81319288-81319310 GCTGAAAAGGGGATGGGAGGAGG - Intergenic
1111375636 13:87376336-87376358 GGTTACAAGAGGCTGGGGGAGGG + Intergenic
1111634100 13:90881337-90881359 GTTTAAAAGGGTGTGGCGGGAGG + Intergenic
1111761097 13:92465942-92465964 GGTTACCAGAGGATGGGGGAGGG + Intronic
1111894440 13:94123702-94123724 TTTGAAAAGGGAGTGGGGGAGGG + Intronic
1111927085 13:94475511-94475533 GGTTACCAGGGGATGGGGGAGGG + Intronic
1112427332 13:99315040-99315062 GGTTAAAAGGGGAGGGAGGAAGG - Intronic
1112495165 13:99898351-99898373 GTTAAAAAGGGGCAGGGGGATGG + Intergenic
1112753952 13:102609691-102609713 GTTTAAAAATGCATGGGGGCTGG - Intronic
1113440008 13:110321490-110321512 GATTAACAGAGGGTGGGGGAAGG - Intronic
1113456966 13:110456194-110456216 GTTTACAAGGGGAAGGTGGTGGG + Intronic
1114370315 14:22079506-22079528 GACCAAAAGGGGATGGGGGGTGG + Intergenic
1114604288 14:23983882-23983904 GTTTATAGGGGGCTGGGGAAGGG + Intronic
1115120380 14:29929804-29929826 AGTGAAAAGGGGAGGGGGGATGG + Intronic
1116429743 14:44832134-44832156 GGTTACCAGGGGTTGGGGGAAGG - Intergenic
1116802167 14:49454323-49454345 CCTGAAAAGGGAATGGGGGATGG - Intergenic
1116870222 14:50062820-50062842 GATTAACTGGGGTTGGGGGAGGG + Intergenic
1116946054 14:50836140-50836162 GTTTAAGAGCGTATGAGGGAGGG - Intergenic
1117012307 14:51483397-51483419 GTTCAAAAATGAATGGGGGATGG + Intergenic
1117031400 14:51674702-51674724 TTTTTAAAGGGTGTGGGGGAAGG - Intronic
1117410696 14:55448291-55448313 GAAAAAAAGGGGATAGGGGAGGG - Intronic
1117599068 14:57354920-57354942 GGTTGCAAGGGGCTGGGGGAAGG + Intergenic
1118012023 14:61619182-61619204 GGTTGCCAGGGGATGGGGGAAGG + Intronic
1118085575 14:62412123-62412145 GTTTCAAATGGGATAGGGGAGGG + Intergenic
1118542580 14:66844885-66844907 GTTTACCAGGGGTTGGGGGAGGG - Intronic
1118594175 14:67423219-67423241 GCCAAAAAGGGGTTGGGGGAGGG + Intergenic
1118651693 14:67902996-67903018 GTTAAAAAGGGCATGGTGGTGGG - Intronic
1118665375 14:68063437-68063459 ATTTAAAAGTGTATGGGGGCTGG + Intronic
1118717516 14:68570658-68570680 GTAAAAATGGGGATGGGGGCTGG - Intronic
1118839900 14:69502291-69502313 GTTTAAAATGGCCTGGGGCAAGG - Intronic
1118996058 14:70837436-70837458 GTTTACCAGGGGCTGGGAGAGGG + Intergenic
1119780598 14:77274469-77274491 GTTGGACAGAGGATGGGGGAGGG - Intergenic
1120635260 14:86943390-86943412 GAGTAAAACGGGATGGGGCAGGG + Intergenic
1120717216 14:87852794-87852816 GTATAAAAGGAGAAGGGGCAAGG - Intronic
1121080403 14:91103335-91103357 GGCTAAAAGGAGAAGGGGGAAGG - Intronic
1121224878 14:92314238-92314260 GTTAAAAAAGGGTTGGGGGTGGG + Intergenic
1121860870 14:97316837-97316859 GTTAAAAGGAGGATGGGAGAAGG - Intergenic
1122373711 14:101244005-101244027 GTTTACCAGGGGATGGGGATGGG - Intergenic
1124374902 15:29123800-29123822 GTTGAGAAGGGGAGGAGGGATGG - Intronic
1125335779 15:38624960-38624982 TTTAAAAAAGGGGTGGGGGAAGG - Intergenic
1126579188 15:50227590-50227612 GGATGAAAGGGGTTGGGGGAAGG - Intronic
1126688470 15:51268085-51268107 CCTTTAAATGGGATGGGGGAGGG - Intronic
1127094253 15:55497108-55497130 TCTTAATAGGGGAAGGGGGAGGG - Intronic
1127301167 15:57655205-57655227 GTGGAAAAGGGGATGGAGGGTGG + Intronic
1127384134 15:58453499-58453521 GTCTAACATGGGCTGGGGGAAGG + Intronic
1127567852 15:60210833-60210855 GGTTGAAAGGGGCTGGGGAAAGG + Intergenic
1127647752 15:60974898-60974920 GTTGAAAAGAGGATGGGGAAAGG + Intronic
1128208828 15:65877186-65877208 TTTTAAAAAGGAATGGGGGTAGG - Intronic
1128739258 15:70072408-70072430 GGTTGAAAGGGGATGGGGTGAGG + Intronic
1129044897 15:72725808-72725830 GGGGAAAGGGGGATGGGGGAAGG - Intronic
1129141462 15:73601921-73601943 GCATAACTGGGGATGGGGGATGG + Intronic
1130575615 15:85090693-85090715 GTTTAGATGGGGGTGGGGGTGGG - Intronic
1131046635 15:89320735-89320757 GTGTTAAAGTGGATGGGAGAGGG + Intronic
1131090903 15:89624429-89624451 CTTTAGAAGGGGGTGGAGGAGGG - Exonic
1131353923 15:91726632-91726654 GTCTACAAGGGGCTGTGGGAAGG - Intergenic
1131789718 15:95951093-95951115 GTTTATATGGGGGTGGGGGTGGG - Intergenic
1132008251 15:98250269-98250291 GGATAAGATGGGATGGGGGATGG + Intergenic
1132056549 15:98654963-98654985 CTTTAAGTGGGGATGGGGGAGGG + Intronic
1133228020 16:4351971-4351993 GGTTGACAGGGGCTGGGGGAGGG - Intronic
1134004971 16:10812727-10812749 ATTTACCAGGGGCTGGGGGAAGG + Intronic
1134014292 16:10877884-10877906 GTTTAAAAAGGGTCAGGGGACGG + Intronic
1135055656 16:19230036-19230058 GATTATCAGGGGCTGGGGGAAGG + Intronic
1135754310 16:25083709-25083731 TTTTAAGAGGGGATGGGTCACGG + Intergenic
1136046328 16:27618032-27618054 GTTTAAAAGGGGATCTTGGTCGG - Intronic
1136254768 16:29030645-29030667 GGCTAAAAGGGCAAGGGGGAGGG - Intergenic
1136734448 16:32451697-32451719 GTTTAAATGGGGATTAAGGATGG - Intergenic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1137897795 16:52232970-52232992 GTTTAGAAGTGGGTGGGGGCTGG + Intergenic
1138050871 16:53776010-53776032 GGGAAAAAGGGGATGGTGGAGGG + Intronic
1139258902 16:65573169-65573191 TTTTCACAGTGGATGGGGGATGG + Intergenic
1140201918 16:72901907-72901929 CTTAAAAAGGGGGTGGGGGAAGG - Intronic
1140835175 16:78787332-78787354 GGTTATGAGGGGCTGGGGGAAGG - Intronic
1140946272 16:79770871-79770893 GTTGCAAAGGGAAAGGGGGAGGG - Intergenic
1141233435 16:82193083-82193105 GTTGAAAAGGTGCTGGGGCAAGG - Intergenic
1141376333 16:83534131-83534153 ATTACAAAGGGCATGGGGGATGG - Intronic
1141923422 16:87151790-87151812 GTTTAAAAGAGTCTGGGGCAGGG + Intronic
1203018632 16_KI270728v1_random:377905-377927 GTTTAAATGGGGATTAAGGATGG + Intergenic
1203036967 16_KI270728v1_random:651063-651085 GTTTAAATGGGGATTAAGGATGG + Intergenic
1142493133 17:291370-291392 TTTTAAAATGAGATGGGGGGTGG - Intronic
1142709962 17:1717656-1717678 GTGGATAAGGGGATGGAGGAGGG - Intronic
1142746338 17:1960713-1960735 GTTTGCCAGGGGCTGGGGGAGGG - Intronic
1143491346 17:7286884-7286906 GGAGGAAAGGGGATGGGGGAAGG - Exonic
1144465191 17:15491322-15491344 TTTTAACTGGGGATGGGGGCAGG + Intronic
1144627566 17:16852110-16852132 GGTTAAAGGGTGATGGGGGTAGG + Intergenic
1144878874 17:18420612-18420634 GGTTAAAGGGTGATGGGGGTAGG - Intergenic
1144964573 17:19068300-19068322 GGTTAGCAGGGGTTGGGGGAGGG + Intergenic
1144983394 17:19183873-19183895 GGTTAGCAGGGGTTGGGGGAGGG - Intergenic
1144984831 17:19194366-19194388 GGTTAGCAGGGGTTGGGGGAGGG + Intergenic
1145153361 17:20523782-20523804 GGTTAAAGGGTGATGGGGGTAGG + Intergenic
1145768842 17:27478244-27478266 GTATAAAAGGGGATGGTGTCAGG + Intronic
1145908348 17:28528556-28528578 GTTTTATGGGGGATGGGGGTAGG - Intronic
1146180543 17:30695445-30695467 GATTGCCAGGGGATGGGGGATGG - Intergenic
1146680113 17:34801110-34801132 GTGGTAAAGGGCATGGGGGATGG - Intergenic
1146953722 17:36923723-36923745 GTTTAGGAGAGTATGGGGGAGGG - Intergenic
1147703801 17:42412269-42412291 GTTTAAATGGGGCTTGGGGTGGG + Intronic
1147999914 17:44381618-44381640 TTTTAAAAGGGGCTTGGGCACGG - Intronic
1148003656 17:44407136-44407158 TTTTAAATTGGGAGGGGGGAAGG + Intronic
1148157773 17:45433156-45433178 GATCAAGAGGGGGTGGGGGATGG - Intronic
1148398543 17:47331737-47331759 GTTTGCCAGGGGATGGGGGAAGG - Intronic
1148817382 17:50339556-50339578 GTTGCACAGGGAATGGGGGATGG - Intergenic
1149031045 17:52082554-52082576 GTCTAAAAGAGGATGAGTGAGGG - Intronic
1149575533 17:57709172-57709194 GATTACCAGGGAATGGGGGAAGG - Intergenic
1150370730 17:64635508-64635530 GGTTGCTAGGGGATGGGGGAGGG - Intronic
1150413781 17:64970118-64970140 TTTAAAAAGGGGGTGGGGGTGGG - Intergenic
1150635733 17:66911867-66911889 GTTAAAAAGAGGATGGGTGGGGG - Intergenic
1150648847 17:66996920-66996942 GTTTATAAGGGGACGAGGGCAGG + Intronic
1151889315 17:76942858-76942880 GTTTGCAAGGGGAGGGGAGAGGG - Intronic
1152202361 17:78954506-78954528 GTTGAGAAGGGGACGGGGGCAGG + Intergenic
1152238110 17:79148897-79148919 GTTTGTAAGGTCATGGGGGATGG + Intronic
1152467578 17:80474801-80474823 TTGTAAAAGGGGAGGGGGGGGGG - Intronic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1153112325 18:1606515-1606537 GTTTTAAAGGATATGGGGAAAGG + Intergenic
1153606368 18:6837452-6837474 GTTTGACTGGGGATGGGGTAGGG + Intronic
1153913995 18:9729648-9729670 ATTTAGAGGGGGGTGGGGGAGGG - Intronic
1154393562 18:13965978-13966000 GGTTACCAGGGGCTGGGGGATGG + Intergenic
1156474707 18:37398186-37398208 TATTGAAAGGGAATGGGGGAAGG - Intronic
1156824036 18:41408162-41408184 CTTTAAAAGGGAAGGGGGTAAGG + Intergenic
1157486033 18:48087834-48087856 TTTTAAAAGTGGGTGGGGGGGGG + Intronic
1157697428 18:49733912-49733934 GTTACAAAGGGGATGCGGGGAGG - Intergenic
1157703771 18:49783278-49783300 GGTTGTCAGGGGATGGGGGATGG + Exonic
1158705007 18:59784424-59784446 GTTTTAAAGGGGAAAGTGGATGG + Intergenic
1159317014 18:66788525-66788547 TTTTAAAAGGGGAATGAGGAAGG - Intergenic
1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG + Intergenic
1160789282 19:915872-915894 ATTTAAGGGGGGAGGGGGGAGGG + Intergenic
1160961131 19:1721440-1721462 GGTTAAAGGGGTGTGGGGGACGG - Intergenic
1161388483 19:4009137-4009159 ATGTGAAAGGGGATGGGGGAGGG - Intronic
1161657639 19:5525740-5525762 GTTGAATAGGGGATGGGAGATGG - Intergenic
1162001037 19:7745236-7745258 GTTCTCATGGGGATGGGGGAGGG - Intronic
1162244268 19:9386315-9386337 GTTTTAAAGGGGATCAGGGAGGG + Intergenic
1162352145 19:10157343-10157365 GTGTGAAAAGGGATGTGGGAAGG + Intronic
1162421008 19:10566067-10566089 GTTTACAAGTGGATGCGGGCGGG - Intergenic
1162461803 19:10818044-10818066 CTTTAGAAGGGGCTAGGGGAGGG - Intronic
1162963756 19:14145542-14145564 GTGGATATGGGGATGGGGGAGGG + Intergenic
1162978049 19:14220095-14220117 GGTTGCCAGGGGATGGGGGATGG + Intergenic
1163165870 19:15497767-15497789 TTTTAAATGGGGGTGGGGGATGG - Intronic
1163213714 19:15860939-15860961 GGTTACCAGGGAATGGGGGAGGG + Intergenic
1163567653 19:18060978-18061000 CTTTAAAATGGGAAGGGGTATGG + Intronic
1163609287 19:18292690-18292712 CTTGAAAAGGGGGTGTGGGAGGG + Intergenic
1163702497 19:18793172-18793194 GTTTGAAAGGGGATGGGTCAGGG + Intergenic
1164147291 19:22519815-22519837 TGTTAAAAGGGGGTGGGGGTCGG - Intronic
1164159309 19:22616295-22616317 TGTTAAAAGGGGGTGGGGGTCGG + Intergenic
1164199057 19:23001872-23001894 GAGAAATAGGGGATGGGGGATGG + Intronic
1164504164 19:28845199-28845221 GTTGAAGAGGGGAAGGGGGTGGG - Intergenic
1164662948 19:29994434-29994456 GGTTACCAGGGGATGGGGGGAGG - Intronic
1164820435 19:31246591-31246613 GTTTAAAAAGGGACAGAGGAAGG + Intergenic
1166385617 19:42378909-42378931 TCTTAAAGGGGGAAGGGGGAAGG + Intergenic
1167665397 19:50820483-50820505 GGGGAAAAGGGGATGGGGCAGGG + Intronic
1167694579 19:51007178-51007200 GTATGAAAGGGGATGGGATATGG + Intronic
926386055 2:12336902-12336924 GTTTACATGGGGAGGGGGGCAGG - Intergenic
926920396 2:17934745-17934767 GCTGAGAAGGGGCTGGGGGAAGG - Intronic
927694763 2:25232234-25232256 TTTTATAATGGGAGGGGGGATGG - Exonic
927910127 2:26891561-26891583 TTTTGAAAGGAGATGGGTGAGGG - Intronic
928797995 2:35047795-35047817 GATTATGAGGGGTTGGGGGAGGG + Intergenic
929163686 2:38859356-38859378 GGTTATGAGGGGCTGGGGGAAGG + Intronic
929191422 2:39144033-39144055 GGTTAACAGGGGCTGGGGGAAGG - Intergenic
929967040 2:46543454-46543476 GTAGGAAAGGGGATGTGGGAAGG - Intronic
930358144 2:50346509-50346531 AATAGAAAGGGGATGGGGGAAGG - Intronic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
930997992 2:57745064-57745086 GGTTATAAGGGAATGGGGGGTGG + Intergenic
931161116 2:59691600-59691622 GGTTAAAAGGGGATGGTGGAAGG + Intergenic
931906217 2:66846516-66846538 GTTTGAAAGGGGCTGGGAGCAGG - Intergenic
931910037 2:66889230-66889252 GTATAAGAGGGGGTGGGGGTGGG - Intergenic
932151983 2:69381433-69381455 GTTGAAAAGAAGATGGGTGAGGG - Intronic
932199927 2:69816861-69816883 GATTAAAAGGGTATGGTGGGTGG - Intronic
932623897 2:73283774-73283796 GTTTCTGAGGGGCTGGGGGAGGG - Intronic
932880856 2:75500733-75500755 GTTGAAAAGGGGAGGGAGGGAGG - Intronic
933280411 2:80326880-80326902 GTGTAAAAGGGAAGGAGGGATGG - Intronic
934311284 2:91867752-91867774 GTTTAAATGGGGATTAAGGATGG + Intergenic
936064959 2:109323973-109323995 GTTTTCCAGGGGCTGGGGGAAGG - Intronic
936239917 2:110778452-110778474 TTTGAAAAGGGGATATGGGATGG + Intronic
936456081 2:112675311-112675333 GTTAAAAAGGATATGGGGGCTGG + Intergenic
936495647 2:113018456-113018478 GTTTATAAGGTAATGGGGGAAGG + Intergenic
936889891 2:117356965-117356987 GGTTGCCAGGGGATGGGGGAGGG - Intergenic
938211765 2:129471695-129471717 GGTTACCAGGGGTTGGGGGAAGG - Intergenic
938877662 2:135549718-135549740 GTTTACCAGGAGTTGGGGGAAGG + Intronic
939330492 2:140753041-140753063 GTTTGCCAGGGGATGGGGGAAGG - Intronic
940382062 2:153026392-153026414 GTTGACAAGGGTTTGGGGGAGGG - Intergenic
940937219 2:159510130-159510152 GGTTACTAGGAGATGGGGGATGG + Intronic
942119026 2:172758454-172758476 GTTGAAAAGATGCTGGGGGAAGG + Intronic
942263596 2:174197681-174197703 GTTTAAAGGGTGAAGAGGGATGG + Intronic
943679429 2:190752466-190752488 GATTTAAGGGGGATGGGGGAAGG - Intergenic
944459598 2:199932699-199932721 GTTGAAAAGGGGGTGGGGTGTGG + Exonic
944620681 2:201512440-201512462 CATTAATAGGGGATGGGGGCAGG - Intronic
945598870 2:211833132-211833154 GATTACAAGGGGATGGGGAAAGG - Intronic
945762609 2:213933093-213933115 GTTTAAATGTGGATGGGTCAGGG - Intronic
945838373 2:214858986-214859008 ATTTAAAAGGAGAGGGGAGAAGG - Intergenic
945908985 2:215625044-215625066 CATTAAAAAGGGCTGGGGGAGGG + Intergenic
946189745 2:218002076-218002098 GGGTAAAGGGGGATGGGAGAGGG - Intronic
946220084 2:218218020-218218042 CTTTTAAAGGAGATGGGGGTGGG - Intronic
946619554 2:221546168-221546190 GCCTATATGGGGATGGGGGAGGG + Intronic
946740295 2:222794565-222794587 ATTTGACAGGGGGTGGGGGAAGG + Intergenic
946966139 2:225040419-225040441 CTTTAAAAAGAGGTGGGGGAGGG - Intronic
946990099 2:225318791-225318813 GTTAAAAGGGGGATGAGGGTGGG - Intergenic
947347092 2:229203285-229203307 TCTACAAAGGGGATGGGGGAAGG + Intronic
947379531 2:229531979-229532001 GGTTGACAGGGGTTGGGGGAAGG + Intronic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948440581 2:237984687-237984709 GTTTAGCAGGGCATGGGGAAGGG - Intronic
948578020 2:238966519-238966541 CTTTTAAAGGGGATGGCAGAGGG + Intergenic
1168885321 20:1247884-1247906 GCTTACAAAGGGTTGGGGGAAGG - Intronic
1168960432 20:1865461-1865483 TTTGAAAAGGGGCTGGGGGTTGG + Intergenic
1169514090 20:6297475-6297497 GTTGTCAAGGGGTTGGGGGAAGG - Intergenic
1169749354 20:8975886-8975908 GTTTAAAAATGGATAGGGGCTGG - Intergenic
1171121911 20:22575856-22575878 AGGTAAAAGGAGATGGGGGATGG - Intergenic
1171123539 20:22584325-22584347 TTTTAAAAGAGGGTGGGGGTGGG - Exonic
1171214109 20:23339958-23339980 GTCTTCATGGGGATGGGGGATGG - Intergenic
1171979703 20:31618967-31618989 GGTTGAAAGGAGATGGGGGCCGG + Intergenic
1172284481 20:33731493-33731515 CTCTAATAGGGGATGAGGGATGG + Intergenic
1173666946 20:44769755-44769777 GTTTAGGAGGGGCTGGGGGTGGG + Intronic
1173671718 20:44803669-44803691 GGAAAAAAGGGGAGGGGGGATGG + Intronic
1174313589 20:49678992-49679014 CATTAAAAGGGGCTGGGGGTGGG + Intronic
1174540685 20:51286933-51286955 CTTCAATAGGGGGTGGGGGAAGG - Intergenic
1174599797 20:51715033-51715055 CTTTAAAAGGGGATAGGGGAAGG - Intronic
1174631549 20:51962653-51962675 TAATAATAGGGGATGGGGGATGG + Intergenic
1174869659 20:54171373-54171395 CTTTAAAAGAGGGTGGAGGAGGG + Intronic
1175003528 20:55656733-55656755 ATTTAGAGTGGGATGGGGGATGG - Intergenic
1175171977 20:57087080-57087102 GGTTAGAAGGGAATGGGGAAGGG - Intergenic
1175742764 20:61431803-61431825 GGTTGCCAGGGGATGGGGGAGGG - Intronic
1176992436 21:15514100-15514122 GTAAAAAAGGGGATGTGAGAGGG + Intergenic
1177945462 21:27463789-27463811 GTTTAAAAAGGGATTTGTGATGG - Intergenic
1178388178 21:32173744-32173766 GTTTACTAGGGGCTAGGGGATGG + Intergenic
1178596392 21:33957233-33957255 GAGGAAAAGGGGATGGGGGAGGG + Intergenic
1179125506 21:38587297-38587319 ATGTTCAAGGGGATGGGGGAGGG + Intronic
1179413892 21:41182516-41182538 ATTCTAAAGGGGAGGGGGGAAGG + Intronic
1180538044 22:16413663-16413685 GTTTAAATGGGGATTAAGGATGG + Intergenic
1181873939 22:25925227-25925249 TTTTAAAATGGGGTGGGGGAGGG - Intronic
1181903158 22:26171369-26171391 ATTCAAAAGGGGGTGGGGGAGGG - Intronic
1181968541 22:26673070-26673092 GTTGAAAAGGGGTGTGGGGAGGG + Intergenic
1182122098 22:27794890-27794912 GATGAGAAGGGGAAGGGGGAGGG + Intronic
1182739512 22:32557297-32557319 ATTCACAAGGGGAGGGGGGATGG + Intronic
1183039062 22:35162443-35162465 TTTTCAAAGGGGGTGGGAGAAGG + Intergenic
1183266668 22:36830960-36830982 TTTAAAAAGTGGATTGGGGAAGG - Intergenic
1184031199 22:41895841-41895863 TGTTGAAAGGGGATGGGGGCTGG + Intronic
1184966165 22:47973743-47973765 GTTTGGCAGGGGGTGGGGGAAGG + Intergenic
949101109 3:146255-146277 TTTTAAAAAAGGGTGGGGGACGG + Intergenic
949878986 3:8647210-8647232 GTTTAAAGGGGCATGTGGGAAGG + Intronic
950149716 3:10677387-10677409 GGTCAACAGGGGTTGGGGGAAGG + Intronic
951674512 3:25221679-25221701 GGTTAAAAAGAGATGGGAGAGGG - Intronic
953344263 3:42161810-42161832 GTCTTGAAGGAGATGGGGGAGGG + Intronic
953677527 3:45014876-45014898 CAGTCAAAGGGGATGGGGGATGG + Intronic
954100147 3:48365879-48365901 GGTTAACAGGGCCTGGGGGAAGG + Intergenic
954582818 3:51712201-51712223 GTCTAAAAGGGGATGGCAGAGGG + Intronic
954897524 3:53989006-53989028 GGTTACCAGGGGTTGGGGGAGGG + Intergenic
955125813 3:56110993-56111015 GTTTTCAAGGGGGTGGGGGTAGG + Intronic
955207993 3:56914825-56914847 GGTTGCCAGGGGATGGGGGAGGG + Intronic
955548550 3:60058056-60058078 GATTACCAGGGGCTGGGGGAGGG + Intronic
956234617 3:67054908-67054930 GGTTACTAGGGGCTGGGGGAAGG - Intergenic
956374414 3:68598812-68598834 GTCCAAAAGGGGATGTGGGTGGG + Intergenic
956529891 3:70206506-70206528 ATTTTACAGGGGATGGGGGTTGG + Intergenic
957563303 3:81854051-81854073 ATGGAAAAGGGGATGAGGGATGG + Intergenic
957928146 3:86841739-86841761 GTTTAAATGGGTATGTGGAATGG - Intergenic
958703439 3:97622257-97622279 GTTTGCCAGGGGCTGGGGGAAGG - Intronic
959055158 3:101560620-101560642 GTTTACCAGGGGCTGGGGAAAGG - Intergenic
959518897 3:107303421-107303443 GTTTGAAAGGTGATGGGGACAGG - Intergenic
959961045 3:112298374-112298396 GTTTACTAGGGGATTGAGGATGG - Intergenic
960007039 3:112791088-112791110 GTTTAAAGGTGGATGCGGGCCGG + Intronic
960084683 3:113577987-113578009 GTTTAAAAGTGGATTGGAGTTGG - Intronic
960640930 3:119822048-119822070 ATTTACAAGGGAATGGGGAAAGG + Intronic
960974695 3:123162792-123162814 CTTTAAAGGGAGATTGGGGAGGG - Intronic
961573087 3:127814331-127814353 GTTCATTAGGGGATGGGGGTGGG - Intronic
961863948 3:129940011-129940033 GTCTAGAAGGGGATGGGGTGTGG - Intergenic
962158224 3:132971619-132971641 GGTTGCTAGGGGATGGGGGAGGG + Intergenic
962628462 3:137250893-137250915 AGTTAAAAGGGGAAGTGGGAAGG + Intergenic
963243496 3:143035009-143035031 GTTTTAAATGGGTGGGGGGAGGG + Intronic
963824975 3:149943687-149943709 GGTTGCTAGGGGATGGGGGAAGG - Intronic
965357121 3:167689661-167689683 TTTTAAAAGGGGGTGGGGGGAGG + Intronic
965661087 3:171042545-171042567 GTTTAAAATGAGGTGGGGCAGGG - Intergenic
965877591 3:173346261-173346283 GGTTAGCAGAGGATGGGGGATGG + Intergenic
966185220 3:177221062-177221084 GTCTAGAAGAGGAAGGGGGAAGG - Intergenic
966274854 3:178153128-178153150 GTTTAGAAGGGTGAGGGGGAGGG - Intergenic
967858637 3:194135683-194135705 GTTAAAAGGGGGCGGGGGGAGGG - Intergenic
967858638 3:194135684-194135706 GGTTAAAAGGGGGCGGGGGGAGG - Intergenic
967976778 3:195039926-195039948 TTTTGATGGGGGATGGGGGATGG + Intergenic
969669134 4:8580183-8580205 GTTGAGAAAGGCATGGGGGAAGG - Intronic
971233714 4:24821918-24821940 AGTAAAAACGGGATGGGGGAAGG + Intronic
971251207 4:24974875-24974897 GTTGAAAGGGGGTTGGGGGAAGG + Intronic
971631579 4:28999381-28999403 GTTAAAGAGGGGATTTGGGAGGG - Intergenic
972152382 4:36109853-36109875 GCTCAAAAGGGGGAGGGGGAGGG - Intronic
972265511 4:37455192-37455214 GATTAAATGGGGAAGGGGGAGGG - Intronic
972724060 4:41730559-41730581 GATTAAAGCGGGGTGGGGGACGG + Intergenic
973847654 4:54929347-54929369 CATTAAAAGGGGATGGGGAAAGG + Intergenic
975780395 4:77833209-77833231 CTTTAAAAGGGGCTGGGGTGGGG - Intergenic
975850048 4:78562968-78562990 GATTACAAGGGGATTGGGGGAGG + Intronic
976318720 4:83687052-83687074 GTTTTAAAGGGTCTGGGTGAGGG - Intergenic
976456473 4:85253308-85253330 GTTTGCAAGGGGCTGAGGGAGGG - Intergenic
977059483 4:92239545-92239567 GTTTATAAGGGGATCATGGAAGG - Intergenic
978221826 4:106286529-106286551 TTTTAAAAAAGGTTGGGGGATGG + Intronic
978937830 4:114399564-114399586 GCTGAAAAGGGGATGGGATAGGG + Intergenic
979270121 4:118749654-118749676 TTTTAAATGGGGGTGGGAGAAGG - Intronic
980329879 4:131397800-131397822 GCTTATCAGGGGTTGGGGGATGG - Intergenic
980654207 4:135760540-135760562 GTTTAAAATGAGATTTGGGATGG + Intergenic
982273107 4:153611638-153611660 GGTTAACAGGGGCTGGGGAAAGG - Intronic
982700015 4:158650210-158650232 GTTTTCTAGGGGTTGGGGGAAGG + Intronic
984538652 4:181009026-181009048 GTTTACACTGGGATGGGGAATGG + Intergenic
984675670 4:182544686-182544708 GTTTAAAAGGTGAGGAGGTAAGG - Intronic
985917155 5:2930845-2930867 GTTTAGCAGGGGATTGGGAAGGG - Intergenic
987220442 5:15785569-15785591 CTTTAATTGGGGATGGAGGAGGG - Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989751261 5:44896506-44896528 GGTTGCCAGGGGATGGGGGAAGG - Intergenic
990202015 5:53386414-53386436 GGTTAGAAGGGGCTGGGGGTTGG - Intergenic
990605376 5:57404059-57404081 GTTTCATAAGGGATGGGGCAGGG + Intergenic
990884990 5:60581035-60581057 GTGTAGCAGGGGATGGGAGAAGG - Intergenic
991264548 5:64701528-64701550 TTTTAGAAGGGGCTGGGGGAAGG + Intronic
991534300 5:67649606-67649628 CTTTAAAAAGGGATGGATGAGGG + Intergenic
991962590 5:72060131-72060153 GGTTGACAGGGGCTGGGGGAGGG + Intergenic
992533851 5:77678493-77678515 GTTGCAGAGGGGATGGAGGAAGG + Intergenic
992778755 5:80109851-80109873 GTTTTATAGGGGCTGGGGGAGGG - Intergenic
993004914 5:82419500-82419522 GTATAAATGGGGGTGGGGGTGGG - Intergenic
993350001 5:86838424-86838446 CTAAAAAAGGGGTTGGGGGAGGG - Intergenic
993374625 5:87135639-87135661 GTTTAGGAGGGGAGAGGGGAGGG + Intergenic
993700924 5:91118277-91118299 GTTGAAAAGGCCTTGGGGGAGGG + Intronic
993705861 5:91169434-91169456 GGTTGCCAGGGGATGGGGGAGGG + Intergenic
993841140 5:92880250-92880272 TTTTTAAAGGGGTTGGGGGATGG + Intergenic
995742245 5:115367154-115367176 GATTCCAAGGGGCTGGGGGAAGG - Intergenic
996206502 5:120744391-120744413 GGTTGGAAGGGGATTGGGGAAGG + Intergenic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
996348838 5:122516193-122516215 ATTTAAAAGGGAGTGGGGGCAGG + Intergenic
997287230 5:132688915-132688937 CTCTAAAAAGGGATGGGGGAGGG + Intergenic
997628086 5:135344965-135344987 GTTTTAAAGGGCCTGGGGAAAGG + Intronic
997820423 5:137061282-137061304 GTGAAAAAGGGAATGGGGTAAGG - Intronic
998073629 5:139218517-139218539 GTTTAAAGGAGGTGGGGGGAGGG - Intronic
998173994 5:139889643-139889665 GTTTGTAATGGGAAGGGGGAGGG - Intronic
998238217 5:140418562-140418584 GATTATGAGGGGCTGGGGGAAGG - Intronic
1000120987 5:158197709-158197731 GTTGAAAAGGGGATTGGAAAAGG - Intergenic
1000440621 5:161259021-161259043 GGAGAAAAGGGGAAGGGGGACGG - Intergenic
1000717509 5:164664449-164664471 GGTTTACAGGGGATGGGGGAAGG + Intergenic
1000881114 5:166698664-166698686 TTTTTAAAGGGCAGGGGGGATGG - Intergenic
1001564582 5:172691148-172691170 TTTTAAAAGTGGATGGGGAGGGG + Exonic
1001986318 5:176076515-176076537 GTTGAAAAGGGGCTGGGGTGGGG + Intronic
1002230551 5:177761609-177761631 GTTGAAAAGGGGCTGGGGTGGGG - Intronic
1002264784 5:178022139-178022161 GTTGAAAAGGGGCTGGGGTGGGG + Intronic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1002934203 6:1657906-1657928 CTTTAAAAAGGGGAGGGGGATGG - Intronic
1003911866 6:10750425-10750447 GTTTAGAATGGGGTGGGGGGGGG + Intronic
1004148914 6:13096160-13096182 GTTTAAAAAAGGAGGGGTGAGGG - Intronic
1004695184 6:18026693-18026715 GTTTAAAAGAGCATGGTGGCCGG - Intergenic
1005782457 6:29206943-29206965 AGTTACTAGGGGATGGGGGAGGG - Intergenic
1007116183 6:39344985-39345007 ATGGAAAAGGGGATGGGGGAGGG - Intronic
1007373955 6:41443757-41443779 GTGTGCGAGGGGATGGGGGAAGG + Intergenic
1008099284 6:47373887-47373909 GATTAAAAGGGATTGGGGCAGGG + Intergenic
1009301061 6:62021249-62021271 GTCTAAAAGAGGATGGAGGGTGG + Intronic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1009661569 6:66619082-66619104 GATAAAAAGGGGATGGTTGATGG + Intergenic
1010225613 6:73486386-73486408 GGTTACCAGGGGCTGGGGGAAGG - Intronic
1010227584 6:73505481-73505503 GGTTACCAGGGGATGGGGGAGGG + Intronic
1010529706 6:76952664-76952686 GTGTAAAAGGGGATGTGGGATGG + Intergenic
1011326557 6:86154603-86154625 GTATTAAAGGGGATGGTGAATGG + Intergenic
1011401972 6:86973158-86973180 ATTTAAAAGGAGAAGGTGGAGGG - Intronic
1013077525 6:106784385-106784407 CTTTAATATGGGATGAGGGATGG + Intergenic
1013184902 6:107749063-107749085 GATTTAAATGGGATGGGAGAGGG + Intronic
1013566571 6:111370394-111370416 GTTGAAAAGGGGCTGGGAGGTGG + Intronic
1013615040 6:111834941-111834963 CTTAAAATGGGGATAGGGGAAGG - Intronic
1014496628 6:122132285-122132307 GTATAAAAGGGCATGGTGCAAGG - Intergenic
1014664825 6:124223940-124223962 GTTTAAAATGAGATGGTGCATGG + Intronic
1015212748 6:130716802-130716824 GGTTAATAGGGGAATGGGGAAGG + Intergenic
1015799585 6:137046599-137046621 CTTTATAATGGGAGGGGGGAAGG + Intergenic
1015946352 6:138505123-138505145 GTGTAAATAGGGATGGGGGCGGG - Intronic
1016584760 6:145672292-145672314 GTTTTAAAGGGATTTGGGGAAGG - Intronic
1017857183 6:158360071-158360093 GCATAAAAGGGAAGGGGGGAAGG - Intronic
1019892010 7:3954525-3954547 GTTGTAAAGGGGAGGTGGGAGGG - Intronic
1020967469 7:14889506-14889528 CTTGAAAAGGAGATGGGAGATGG + Intronic
1021204880 7:17768136-17768158 GTTTACCAGGGGCTGCGGGAAGG - Intergenic
1021273996 7:18626460-18626482 GTTAAAATGGGGATGTTGGAGGG - Intronic
1021276034 7:18652600-18652622 GTTGTCAAGGGGATGGGGCATGG - Intronic
1022028058 7:26466985-26467007 GTTCAAGAGAGGATGGGAGAAGG + Intergenic
1022815720 7:33912394-33912416 GTTTGAAATGGGATGGGGAAGGG - Intronic
1022833824 7:34094709-34094731 GTGTAAAAGGGGATGCGGAGAGG + Intronic
1025767354 7:64468035-64468057 ATTAAAAAGGAGATGGGGGCTGG + Intergenic
1026474400 7:70722137-70722159 TTTTAAAAGGGGTTGGGGCCGGG - Intronic
1026523713 7:71137015-71137037 GGTGAAAAGGGGGTGGGGGTGGG - Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027628985 7:80579039-80579061 GTTTAAAAGGGGAAGAAAGAAGG + Intronic
1028224313 7:88232269-88232291 GGTTACCAGGGGCTGGGGGAGGG + Intergenic
1028538126 7:91912075-91912097 GTTTAAGAGAGAATGGGGGATGG + Intergenic
1028722347 7:94048037-94048059 GTTTAAAAAAGGAGGGGGAATGG + Intergenic
1028950205 7:96626147-96626169 GTTTGGAAGGGGAGGTGGGATGG - Intronic
1030047579 7:105511326-105511348 GTTTAAACGGGAATGGGGCCAGG - Intronic
1030111127 7:106027826-106027848 TTTAAAAAGGGGATGGGGGCTGG + Intronic
1030672603 7:112353493-112353515 GATTACCAGGGGCTGGGGGATGG + Intergenic
1030746148 7:113168917-113168939 TTTTAAAAGAGGATCGGAGAAGG - Intergenic
1030934649 7:115570455-115570477 TTTTAAAAAGGGGAGGGGGATGG - Intergenic
1032248499 7:130232956-130232978 GTTTGAGAGGCCATGGGGGAGGG + Intergenic
1032310725 7:130784301-130784323 GTTCAGAAGGTAATGGGGGAAGG + Intergenic
1032546270 7:132746281-132746303 GTAGAAACGGGGGTGGGGGAAGG - Intergenic
1032573706 7:133029402-133029424 GATTACCAGGGGATGTGGGATGG - Intronic
1033358445 7:140620337-140620359 GTTTAAAAGGGGTGGGGGGGGGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1035981869 8:4381428-4381450 ATTGAAAAGGGGGTGGGGGCTGG + Intronic
1036560262 8:9895802-9895824 ATTTTCAAGGGGCTGGGGGAAGG + Intergenic
1036596386 8:10216581-10216603 GGTTACCAGGGGCTGGGGGAAGG - Intronic
1036799224 8:11777347-11777369 TTTTAAAAGGCGGTGGGGGTGGG - Intronic
1036951089 8:13140060-13140082 GGTTACCAGGGGCTGGGGGAAGG - Intronic
1037200762 8:16249720-16249742 GTTTAAAAAGGGAAGTTGGAAGG + Intronic
1037369319 8:18157555-18157577 GTATAAAAGGGCATGCAGGATGG - Intergenic
1037672227 8:21024839-21024861 GTTCAAAATGGGATTTGGGAGGG + Intergenic
1037811755 8:22090485-22090507 TTTTGACTGGGGATGGGGGAAGG - Intronic
1037839074 8:22231492-22231514 GTTTGAATGGGCATGGGGAAGGG - Intronic
1040047982 8:42982306-42982328 GGTTACCAGGGGATAGGGGAGGG + Intronic
1040407862 8:47125733-47125755 GATTAAAAGGGGCAGGGGGCAGG + Intergenic
1040856183 8:51950406-51950428 GGTTGCCAGGGGATGGGGGAAGG + Intergenic
1040863282 8:52022822-52022844 GCTCACAAGGGGATGGGGGTAGG - Intergenic
1040913601 8:52545546-52545568 AGTTGAAGGGGGATGGGGGAGGG - Intronic
1041085011 8:54248650-54248672 GGTTACCAGGGGCTGGGGGAAGG + Intergenic
1041147394 8:54891467-54891489 GTATAAATGGGCATGGGAGAGGG - Intergenic
1042592791 8:70413918-70413940 ATCTAAAAGGGCATGGGGGTGGG - Intergenic
1043224240 8:77702468-77702490 GGTTACCAGGGGTTGGGGGAAGG - Intergenic
1044024961 8:87157609-87157631 CTTCAAAAGGGGATGGAGAAGGG - Intronic
1045327486 8:101127508-101127530 GTATAAAATGGGGTGGGGGTGGG + Intergenic
1045816257 8:106280558-106280580 GTTTGCAAGGGGATGGGTGATGG + Intronic
1046617293 8:116491247-116491269 GTTTATGAAGGGTTGGGGGATGG - Intergenic
1047227516 8:122969222-122969244 GTTGACCAGGGGATGGGGCAGGG + Intronic
1047737550 8:127779849-127779871 ATTTGAATGGGGATGGGGAAGGG + Intergenic
1047754259 8:127906596-127906618 GTTGAGAGGGGGATGGGGGGTGG + Intergenic
1047767206 8:127999756-127999778 TGTTAAAAGTGGATGGGGGCCGG - Intergenic
1048654521 8:136521211-136521233 TTTTAAAAGGGGCAGGGGGCAGG - Intergenic
1048707852 8:137174360-137174382 GTTTACCATGGGATGGGGGAAGG - Intergenic
1048884207 8:138896339-138896361 TTTTAAAAGGGGAAGGGTAAAGG + Intronic
1048945489 8:139443310-139443332 GTTTCCAACGGGGTGGGGGAGGG - Intergenic
1050046474 9:1551794-1551816 GGTTAACAGGGTATGGTGGAGGG + Intergenic
1050377546 9:4988156-4988178 GTCTAAAAGGGAGTGGGGAAGGG - Intronic
1050530853 9:6588111-6588133 GTTTAAAAGGGGGTGGGGGTGGG + Intronic
1051722190 9:20048846-20048868 GTTAAAAATAGGATGGGGGTGGG - Intergenic
1052681271 9:31696267-31696289 GCTAAGAAGGGAATGGGGGAAGG + Intergenic
1052703042 9:31960595-31960617 GTTTTAGGGGGGATGTGGGAGGG - Intergenic
1052743790 9:32419306-32419328 TTTTAAAAGGAGATGAGGTAAGG + Intronic
1053422695 9:37989798-37989820 GTTTTAAAGAGGAGTGGGGAAGG + Intronic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1056008147 9:82296114-82296136 GTGAAAAAGAGGATGGGAGAAGG - Intergenic
1056969525 9:91190918-91190940 TTGTAAAAGGGGCTGGGGGGTGG - Intergenic
1057832307 9:98416819-98416841 GTTTAATAGGTGATGGGAGGAGG - Intronic
1059028402 9:110662388-110662410 GATTACAAGGGACTGGGGGAGGG - Intergenic
1059524736 9:114980192-114980214 GTTTACAAGGGGATGAGAGAAGG + Intergenic
1059817259 9:117930883-117930905 GATTAAGGGGGGATGGGGGAAGG + Intergenic
1060108581 9:120890653-120890675 ATTTCAAAGGGCATGGGGGAGGG + Intronic
1060422281 9:123477791-123477813 ATTTAAAAGGGGCTGGAGGGAGG - Intronic
1060861480 9:126958196-126958218 ATTTCAAGGGGAATGGGGGAGGG + Intronic
1062493924 9:136822650-136822672 TTTGAAAATGTGATGGGGGAGGG - Intronic
1185596101 X:1307948-1307970 GTCTAAAGGGGAAGGGGGGAAGG - Intronic
1186484249 X:9921622-9921644 GGTTGTTAGGGGATGGGGGAAGG - Intronic
1186732083 X:12420612-12420634 GTGTAAATGGGGATGGGGCAGGG - Intronic
1187514984 X:19960791-19960813 GTTTGAAAGGGGATGAGGTGGGG - Intronic
1187552912 X:20323913-20323935 GTTTAAAAGGCAATGGGAGGTGG - Intergenic
1187647374 X:21363299-21363321 GGTTACCAGGGGCTGGGGGAAGG - Intergenic
1187649132 X:21380879-21380901 TTTTAAAAAAGGTTGGGGGAAGG + Intronic
1187852208 X:23602203-23602225 TTGTGAAAGGGGATGGAGGAAGG - Intergenic
1188803418 X:34559140-34559162 CTTTTAAAGAGGATGGGGGGAGG + Intergenic
1189123424 X:38419841-38419863 GATTACCAGAGGATGGGGGATGG + Intronic
1189330951 X:40144982-40145004 GATTAAAAGGGGCGGGGGGAGGG - Intronic
1189390341 X:40570957-40570979 GGTTAAAAGCGGAACGGGGAAGG + Intergenic
1189506881 X:41620195-41620217 TTTTAAAAGGGAATAGTGGAAGG + Intronic
1189718022 X:43884492-43884514 TTTTTAAAAGGGATGGGGGTGGG + Intergenic
1190215955 X:48479559-48479581 CATTAAAAGGGGATGGGGCCAGG + Intronic
1190231218 X:48583479-48583501 GTTTAACAGGGGCAGGGGGCAGG - Intergenic
1190327617 X:49216340-49216362 GTTTATCAGGGGATGAGGCAGGG - Intronic
1190722091 X:53157833-53157855 GTTTTCAAGGGGATGGGGGTGGG - Intergenic
1192444429 X:71200002-71200024 GGTAAAAAGGGGAAGGGGGATGG - Intergenic
1192664397 X:73072613-73072635 GTTTACCAGGGGCTGGGGCAAGG + Intergenic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1195261698 X:103138469-103138491 GATGAAATGGGGAAGGGGGAGGG - Intergenic
1195643296 X:107201362-107201384 GTTTACCAGGGGCTGGAGGAGGG - Intronic
1196705538 X:118714271-118714293 GGTTACAAGGGGCTGGGAGAGGG - Intergenic
1197446256 X:126554151-126554173 TTGCAAAAAGGGATGGGGGAAGG - Intergenic
1197479482 X:126964799-126964821 CTTTACATGGGGATGGGGGAGGG + Intergenic
1197840179 X:130737893-130737915 GTTCACAAGGGGCTGGAGGATGG + Intronic
1198276779 X:135102056-135102078 CCTTACAAGGGGATGGGGGAGGG - Intergenic
1198499124 X:137225176-137225198 GTTGAAGAGAGGATGAGGGAAGG - Intergenic
1198563215 X:137874743-137874765 GTTTGCTAGGGGCTGGGGGAAGG + Intergenic
1199698860 X:150362285-150362307 GGTGAAAATGGGAAGGGGGATGG + Intronic
1199732204 X:150646264-150646286 GTATATACGGGTATGGGGGAGGG - Intronic
1200174438 X:154103054-154103076 GTTTAAAAGAGAATGGAAGAAGG - Intergenic
1200949185 Y:8877401-8877423 CTTTAAAAGAGGATGGGTAAGGG - Intergenic
1201887705 Y:18903963-18903985 AGGTAAAAGGGGATGGAGGAAGG + Intergenic