ID: 901632286

View in Genome Browser
Species Human (GRCh38)
Location 1:10653732-10653754
Sequence CAGCCCCGAGATCTTGCTGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901632276_901632286 17 Left 901632276 1:10653692-10653714 CCAGGGCCAGGGGGATTGAGCCA 0: 1
1: 0
2: 1
3: 14
4: 211
Right 901632286 1:10653732-10653754 CAGCCCCGAGATCTTGCTGTTGG 0: 1
1: 0
2: 1
3: 6
4: 87
901632283_901632286 -3 Left 901632283 1:10653712-10653734 CCAGGCAGGCCCTGGGGCAGCAG 0: 1
1: 0
2: 16
3: 100
4: 740
Right 901632286 1:10653732-10653754 CAGCCCCGAGATCTTGCTGTTGG 0: 1
1: 0
2: 1
3: 6
4: 87
901632278_901632286 11 Left 901632278 1:10653698-10653720 CCAGGGGGATTGAGCCAGGCAGG 0: 1
1: 0
2: 1
3: 23
4: 252
Right 901632286 1:10653732-10653754 CAGCCCCGAGATCTTGCTGTTGG 0: 1
1: 0
2: 1
3: 6
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901632286 Original CRISPR CAGCCCCGAGATCTTGCTGT TGG Exonic
901632286 1:10653732-10653754 CAGCCCCGAGATCTTGCTGTTGG + Exonic
905478598 1:38246052-38246074 CAGCACCCAGATCTGGCTGTTGG + Intergenic
906246011 1:44274784-44274806 CAGCCCAGAGTGCTTGCTGCTGG - Intronic
908872945 1:68635363-68635385 CAGCCCAGTAACCTTGCTGTTGG + Intergenic
910191532 1:84600872-84600894 CAGCCCCATGCTCTTCCTGTTGG - Intergenic
922570445 1:226631636-226631658 CAGCCCTGAGACCTGGCTGAGGG - Intergenic
923868376 1:237964231-237964253 CAGCACCAAGATTTTGCAGTGGG + Intergenic
1063390409 10:5646480-5646502 CAGCCCCGTGACCTTGCTCAGGG + Intronic
1065474438 10:26118927-26118949 CAGCTCCAAGCTCTTTCTGTTGG + Intronic
1073658209 10:105441205-105441227 CAGCCCCAAGGTCTTACAGTTGG - Intergenic
1074534046 10:114315908-114315930 CAGCCCTGGGATCTGGCTGCTGG - Intronic
1074710088 10:116169932-116169954 CAACCCCTAGACATTGCTGTGGG + Intronic
1076713691 10:132352746-132352768 CAGCCCCGAGGCCTCCCTGTGGG + Intronic
1077046752 11:550085-550107 CAGGTCCGAGATGTTGTTGTAGG - Exonic
1080392490 11:31861197-31861219 CACGCCCCAGATCTTGCTGCAGG - Intronic
1083309369 11:61776619-61776641 CAGCCCTGGCTTCTTGCTGTGGG + Intronic
1084526821 11:69703261-69703283 CAGCCCCTGCATCTTGCCGTCGG + Exonic
1085527416 11:77172478-77172500 CAGTGCGGAGATCTTCCTGTAGG + Intronic
1089452547 11:118608110-118608132 CCGCCCCAAGGTCCTGCTGTGGG - Intronic
1092680988 12:10981067-10981089 CAGCCCTGAGAACTGGCTGAGGG - Intronic
1098493571 12:71110015-71110037 CAGCCCCTAGACGCTGCTGTGGG - Intronic
1100129822 12:91477984-91478006 CAGTCCAGAGTTCTTGTTGTAGG + Intergenic
1102957797 12:117070603-117070625 CAGCGCCAAGATCCTGCTGTAGG - Intronic
1104280631 12:127373356-127373378 CAGCCACTAGAACTTGCTGATGG + Intergenic
1110315646 13:74102739-74102761 CAGGTCTGAGATCCTGCTGTAGG - Intronic
1113130336 13:107029491-107029513 CAGCCCCTTTATCTTGCTGAAGG + Intergenic
1121316619 14:92964677-92964699 CAGCCTCCAAATCTTCCTGTGGG - Intronic
1124344392 15:28912490-28912512 AAGCCCCAAGCTCTAGCTGTTGG + Intronic
1128467542 15:67925443-67925465 CTGTCCCCAGATCTTGCTCTTGG + Intergenic
1128796453 15:70470038-70470060 CAGCCCTGAGTTCATGCTGTGGG - Intergenic
1139259629 16:65579173-65579195 CAGCCCCGACATCCTGCTACTGG - Intergenic
1139650923 16:68361693-68361715 CTGGCCCGAGCTCTTGCTGGTGG + Exonic
1141102779 16:81210219-81210241 CAGCCCTGACACCTTGGTGTCGG - Intergenic
1143141009 17:4741776-4741798 AAGCCCCGACAGCTTACTGTGGG + Exonic
1143719416 17:8799295-8799317 CAGCCCCCAGGTCCTGCCGTTGG + Exonic
1143913045 17:10267692-10267714 CAGACCAGAGATGTGGCTGTGGG - Intergenic
1146669754 17:34728789-34728811 CAGCCCTTAGATGCTGCTGTGGG - Intergenic
1147440804 17:40446045-40446067 CAGCCCCTAGATATTCCTGGAGG - Intronic
1148141930 17:45335113-45335135 CAGCCAGGTGCTCTTGCTGTGGG - Intergenic
1149237322 17:54607492-54607514 CCACCCCGAGATGCTGCTGTGGG + Intergenic
1151925587 17:77193828-77193850 CAGCCCCCAGGCCTTGCTGCAGG + Intronic
1152880174 17:82810070-82810092 CTGCTCCGAGAGCTTTCTGTGGG + Intronic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1161671778 19:5616127-5616149 CAGCCCCCAGAGCATGCTGTAGG - Exonic
1161686297 19:5704275-5704297 GAGCCCTGAGATCCCGCTGTGGG - Intronic
1163420572 19:17211725-17211747 CAGCACCGAGAGCCTGCTGGAGG + Exonic
1164571803 19:29380131-29380153 GAGCCACGAGCTCCTGCTGTAGG + Intergenic
1164715987 19:30390731-30390753 CAGCCCCGTGAGCTTACTGGAGG + Intronic
926087556 2:10029564-10029586 CAGCCCCAAGGCCTTGTTGTAGG + Intergenic
930018091 2:46984549-46984571 CAGCCCCTAGAGGTGGCTGTCGG - Intronic
937441088 2:121916837-121916859 CTGCCCCTAGATCATGCTATGGG - Intergenic
1170737743 20:19026057-19026079 CAGCCCCGAGTTCCTGATTTAGG - Intergenic
1182429984 22:30293668-30293690 CAGCCCCAAGATCATGCAGGAGG - Exonic
1182572555 22:31249709-31249731 CAGTGCCCAGATCTTGCTGCCGG + Intronic
1183344620 22:37300547-37300569 GGGCCCTGAGATCTGGCTGTGGG - Intronic
1184613828 22:45624340-45624362 CAGCCCAAAGAACTTGCTCTGGG + Intergenic
1184853937 22:47136340-47136362 CAGCCCCAGGATCTTGAGGTTGG - Intronic
953497807 3:43403467-43403489 CTGCCCTGAGCTCTTGCTGTTGG - Intronic
954708170 3:52492095-52492117 CAGCTCCGAGATCTTCCTCCTGG + Exonic
956111402 3:65873292-65873314 CAGGCCTGAGAGCTTGCCGTGGG - Intronic
961556657 3:127700824-127700846 AAGCCCCGATAGCTTGCTTTTGG + Intronic
961738062 3:129014752-129014774 CAGCCCTGTGATTTTGCTATGGG - Intronic
962634873 3:137320007-137320029 CAGACCAGAGATGTTCCTGTTGG + Intergenic
965516692 3:169629544-169629566 CAGCCGAGAGCTCCTGCTGTTGG + Intronic
969935990 4:10681773-10681795 GAGCCCCGAGCTCCTGCTCTCGG - Intronic
970116349 4:12700736-12700758 CAGCCCTGATATCTTGCCTTGGG - Intergenic
971329794 4:25673110-25673132 CACCTCCCGGATCTTGCTGTGGG + Exonic
973534257 4:51865482-51865504 CAGACCAGAGAGCTTGCTGGGGG + Intronic
978566654 4:110089795-110089817 CAGCCCTGAGGTCTTTCCGTTGG - Intronic
979016656 4:115442543-115442565 CTGCAACGAGATCTTGCTTTAGG + Intergenic
982073849 4:151719380-151719402 CAGCTCTGAGAACTTGCAGTGGG + Intronic
983213546 4:164981472-164981494 CAGCCCTGAACTCTTGTTGTAGG - Intergenic
986785200 5:11107897-11107919 TGGCCCCTAGCTCTTGCTGTGGG - Intronic
997461043 5:134052763-134052785 TAGCCCCGACACCATGCTGTGGG + Intergenic
1000113341 5:158130040-158130062 AAGCACCGAGTTCTTGCTGAAGG - Intergenic
1002850769 6:994968-994990 CACTCCAGAGATCTTCCTGTGGG - Intergenic
1003778067 6:9391432-9391454 CAGCCCCGTGACCTTGCTCCTGG - Intergenic
1011841906 6:91511270-91511292 AAGCACCTAGATCTTGCTTTTGG - Intergenic
1019820769 7:3241186-3241208 CATCTGCGAGAGCTTGCTGTGGG + Intergenic
1024828631 7:53421765-53421787 CAACCCCCATATCCTGCTGTGGG + Intergenic
1026128342 7:67598945-67598967 CACACCCAAGATCATGCTGTGGG - Intergenic
1034455679 7:151168349-151168371 CAGCCCCGCGCTCTCGCTGGAGG - Intronic
1035083071 7:156233528-156233550 CAGCCCCAAGACCTTGCAGGCGG + Intergenic
1035845078 8:2854419-2854441 CAGCCCAGTGATATTGCTTTTGG - Intergenic
1042811581 8:72831194-72831216 GAGCACAGAGCTCTTGCTGTGGG - Intronic
1045643911 8:104281769-104281791 CAGCCCCAAGATCTTCTAGTTGG + Intergenic
1048328561 8:133456760-133456782 CAGCGCCGAGCTCTAGCTGCAGG - Exonic
1049438308 8:142597794-142597816 CAGCTCCCAGATCCTGCTGCAGG - Intergenic
1049492875 8:142914438-142914460 CAGCCCTCAGATCTTGGTGCTGG + Intronic
1051852814 9:21528582-21528604 GAGCCCAGAGCTCTTGGTGTGGG - Intergenic
1057253420 9:93522917-93522939 CAGCACTGAGACCTAGCTGTTGG + Intronic
1058835411 9:108855346-108855368 CAGCCCCGAGGTCTTGCCGTAGG + Exonic
1061219347 9:129241324-129241346 CAGCCCCCAGTTCTTGATTTAGG - Intergenic
1187137277 X:16560338-16560360 TAGCCACAAGAACTTGCTGTGGG + Intergenic
1198657368 X:138929399-138929421 CTGCCCCTAGATCTTGTGGTAGG - Intronic