ID: 901633094

View in Genome Browser
Species Human (GRCh38)
Location 1:10657340-10657362
Sequence GCCGGCCGTCACCGAGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 184}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901633094_901633101 -4 Left 901633094 1:10657340-10657362 CCACAGCCTCGGTGACGGCCGGC 0: 1
1: 0
2: 0
3: 10
4: 184
Right 901633101 1:10657359-10657381 CGGCCGTGGGGAGGCCACTCTGG 0: 1
1: 0
2: 0
3: 17
4: 147
901633094_901633103 1 Left 901633094 1:10657340-10657362 CCACAGCCTCGGTGACGGCCGGC 0: 1
1: 0
2: 0
3: 10
4: 184
Right 901633103 1:10657364-10657386 GTGGGGAGGCCACTCTGGAGAGG 0: 1
1: 0
2: 1
3: 38
4: 335
901633094_901633105 21 Left 901633094 1:10657340-10657362 CCACAGCCTCGGTGACGGCCGGC 0: 1
1: 0
2: 0
3: 10
4: 184
Right 901633105 1:10657384-10657406 AGGCCACACCATGACGACTGTGG 0: 1
1: 0
2: 0
3: 14
4: 116
901633094_901633108 28 Left 901633094 1:10657340-10657362 CCACAGCCTCGGTGACGGCCGGC 0: 1
1: 0
2: 0
3: 10
4: 184
Right 901633108 1:10657391-10657413 ACCATGACGACTGTGGAGAAGGG 0: 1
1: 0
2: 1
3: 11
4: 98
901633094_901633107 27 Left 901633094 1:10657340-10657362 CCACAGCCTCGGTGACGGCCGGC 0: 1
1: 0
2: 0
3: 10
4: 184
Right 901633107 1:10657390-10657412 CACCATGACGACTGTGGAGAAGG 0: 1
1: 0
2: 1
3: 11
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901633094 Original CRISPR GCCGGCCGTCACCGAGGCTG TGG (reversed) Intronic
900364790 1:2306711-2306733 GCGGGCCCGCCCCGAGGCTGCGG + Exonic
901318521 1:8324716-8324738 GCCGGGGCTCACCGAGGATGGGG - Exonic
901489853 1:9591111-9591133 GCGGGCCCTGACTGAGGCTGTGG - Intronic
901633094 1:10657340-10657362 GCCGGCCGTCACCGAGGCTGTGG - Intronic
903711414 1:25327718-25327740 ACTGGCCCTCACCGAGGCTAGGG - Intronic
903715534 1:25363711-25363733 ACTGGCCCTCACCGAGGCTAGGG + Intronic
904192034 1:28753011-28753033 TCCTGCTGTCACCCAGGCTGGGG - Intronic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
906154507 1:43606174-43606196 GCCGGCCAGCCCTGAGGCTGTGG - Intronic
906678607 1:47710069-47710091 GCCGGCTGGCGCCGAGGCCGCGG + Intergenic
912472084 1:109912852-109912874 GACGGCAGTCACGGGGGCTGGGG - Intronic
912911003 1:113759184-113759206 GCCGGCTGCCTCCGAAGCTGGGG - Exonic
915111019 1:153564741-153564763 CCCTGCCTTCACCGAGGCAGGGG + Intronic
921842131 1:219839745-219839767 GCAAGCCGGCAGCGAGGCTGAGG + Intronic
1070152196 10:73811747-73811769 GCCCGCCGTCTCGGAGGCCGCGG - Intronic
1070347974 10:75564250-75564272 GCAAGGCGTCAGCGAGGCTGGGG - Intronic
1070846899 10:79530602-79530624 TCCGTCCGTCACCCAGGCTGGGG + Intergenic
1070926898 10:80229675-80229697 TCCCTCCGTCACCCAGGCTGGGG - Intergenic
1072503851 10:96044318-96044340 GCCGGCAGTGACCGCGCCTGGGG + Intronic
1072618913 10:97067249-97067271 CCTGGCAGTCACTGAGGCTGAGG - Intronic
1073154527 10:101335890-101335912 TCTGGCTGTCACCCAGGCTGGGG - Intergenic
1073446698 10:103585215-103585237 GCGGGCACTCACCGAGGATGCGG - Exonic
1076799155 10:132812636-132812658 GCCTGCAGTCACAGAGGGTGGGG + Intronic
1076839792 10:133040428-133040450 GCCAGCTGTCCCCGAGGATGTGG + Intergenic
1076888692 10:133273886-133273908 GGCGGCCCTCCCCGAGCCTGTGG - Intronic
1076948309 10:133665999-133666021 GCCGGCCGGCGCGGCGGCTGTGG - Intergenic
1076949298 10:133669309-133669331 GCCGGCCGGCGCGGCGGCTGTGG - Intronic
1076950282 10:133672608-133672630 GCCGGCCGGCGCGGCGGCTGTGG - Intergenic
1076951267 10:133675907-133675929 GCCGGCCGGCGCGGCGGCTGTGG - Intergenic
1076952257 10:133679217-133679239 GCCGGCCGGCGCGGCGGCTGTGG - Intergenic
1076953245 10:133682527-133682549 GCCGGCCGGCGCGGCGGCTGTGG - Intergenic
1076955213 10:133742178-133742200 GCCGGCCGGCGCGGCGGCTGTGG - Intergenic
1076956203 10:133745488-133745510 GCCGGCCGGCGCGGCGGCTGTGG - Intergenic
1076957191 10:133748797-133748819 GCCGGCCGGCGCGGCGGCTGTGG - Intergenic
1076958180 10:133752107-133752129 GCCGGCCGGCGCGGCGGCTGTGG - Intergenic
1076959164 10:133755406-133755428 GCCGGCCGGCGCGGCGGCTGTGG - Intergenic
1076960153 10:133758716-133758738 GCCGGCCGGCGCGGCGGCTGTGG - Intergenic
1079128534 11:17734950-17734972 GCCGGCCGAGACGGGGGCTGCGG - Exonic
1080450482 11:32374917-32374939 GGAGGCCTTCCCCGAGGCTGGGG - Intergenic
1084029554 11:66473351-66473373 GCCGGCGGTCACAGAGGATGCGG - Exonic
1086484744 11:87286574-87286596 GGCGCCCGTCAGAGAGGCTGGGG + Intronic
1089294317 11:117458799-117458821 GCTGGCCTACACCCAGGCTGGGG - Exonic
1089849750 11:121486040-121486062 GCTGGTCCACACCGAGGCTGTGG + Intronic
1092140019 12:6177510-6177532 GTGGGCCGTCATCGAGGCAGTGG - Intergenic
1094523985 12:31219756-31219778 GCCGGCCTGCACAGGGGCTGGGG - Intergenic
1096668065 12:53180465-53180487 CCCGGCCGCCATCGAGACTGAGG - Intronic
1097567890 12:61294186-61294208 GCAAGGCGGCACCGAGGCTGGGG + Intergenic
1099912189 12:88847403-88847425 GCAAGGCGGCACCGAGGCTGGGG + Intergenic
1101401757 12:104394270-104394292 GCAAGGCGTCAGCGAGGCTGGGG - Intergenic
1102471804 12:113163567-113163589 GCCGGCTGTCACATAGCCTGGGG - Intronic
1102951415 12:117033925-117033947 GCCTGCAGTTAACGAGGCTGCGG - Intergenic
1104869339 12:131983493-131983515 GACGGCTGGCACCGAGGCTGTGG - Intronic
1106995023 13:35471176-35471198 CCGGGCCGTTCCCGAGGCTGCGG - Intronic
1115399216 14:32939052-32939074 GCCGGCCGCCCGCGAGGCTCCGG + Intronic
1118259350 14:64233129-64233151 GCCAGGCGTCACTGAGACTGTGG + Exonic
1122147067 14:99697790-99697812 GCCTGCTGTCCCAGAGGCTGGGG - Intronic
1125499869 15:40232849-40232871 GCCTGCCGTGACAGGGGCTGTGG - Intergenic
1125508615 15:40281464-40281486 GCAGGCGGGCACCGAGGCTGTGG - Exonic
1127789879 15:62390412-62390434 GTGGGCCGCCACCGAGGCTCAGG - Intergenic
1128684466 15:69673384-69673406 GCTGGGCGTCCCCGAGGATGGGG + Intergenic
1131178602 15:90225271-90225293 GCCGGCCGTCACCTGGGGTGTGG - Exonic
1132555756 16:571765-571787 GCCGACCGTCCCAGAGGCTGAGG + Intronic
1132628966 16:907472-907494 TCCGGCGGGCACAGAGGCTGTGG + Intronic
1135712557 16:24729940-24729962 GCCGGGCGTCCCCGAGACTTCGG + Intronic
1136246829 16:28981142-28981164 GGAATCCGTCACCGAGGCTGGGG + Intronic
1136991903 16:35157804-35157826 GCAAGGCGGCACCGAGGCTGGGG + Intergenic
1137655115 16:50153098-50153120 GCCGTGCGTCACAGAGGCCGCGG - Intronic
1142301023 16:89257795-89257817 GCCTGTCCTCACCGAGGCCGGGG + Intergenic
1142978536 17:3658857-3658879 GCCAGCCTGCACAGAGGCTGGGG + Intronic
1143322096 17:6075049-6075071 GCTGCCAGTCACTGAGGCTGAGG + Intronic
1145770851 17:27492001-27492023 GTCGGCCTCCACCAAGGCTGTGG + Intronic
1146085248 17:29822391-29822413 GCACTCCGTCACCTAGGCTGGGG + Intronic
1147910708 17:43854295-43854317 GGTGGCCGTCCCTGAGGCTGGGG - Intronic
1149755116 17:59179968-59179990 GCCAGCAGTCTGCGAGGCTGGGG - Intronic
1149847377 17:60015944-60015966 GGGGGCCGGCACCCAGGCTGGGG - Intergenic
1151773208 17:76178340-76178362 GCCAGCTGTCTGCGAGGCTGTGG - Intronic
1153688262 18:7567447-7567469 GCCGGCCGTGGCCGTGGCGGTGG - Exonic
1154152123 18:11914677-11914699 TCCCTCCGTCACCCAGGCTGGGG + Intergenic
1160773412 19:843815-843837 GCCGGCCCTTCCCGAGGCCGCGG - Intronic
1160913180 19:1484053-1484075 GCCGGCCGCCAGTGGGGCTGAGG + Exonic
1161355825 19:3819219-3819241 GCCGGCCGCCGCCCGGGCTGTGG + Exonic
1163148641 19:15398687-15398709 GCCGGGCGCCGGCGAGGCTGAGG + Intronic
928694947 2:33840195-33840217 CCAGGCAGTCACCGAGGCTTCGG + Intergenic
929501560 2:42494565-42494587 GGCAGGCGGCACCGAGGCTGGGG - Exonic
929646862 2:43637175-43637197 ACCGGGCGTCACCGGGGGTGTGG - Intergenic
932331240 2:70899693-70899715 TCCCGCCTTCTCCGAGGCTGAGG - Intergenic
937369052 2:121285195-121285217 GCCGGCCGGCACCGCGGGTTCGG - Exonic
939777640 2:146406152-146406174 GCAGGGCGGCAGCGAGGCTGGGG + Intergenic
940901652 2:159131460-159131482 GCCTGCTGTCACCGAGGCTCTGG + Intronic
940920233 2:159297761-159297783 TCTGGCTGTCACCCAGGCTGGGG + Intergenic
948910309 2:240999257-240999279 GCCGCCGGGCACCGAGGCGGGGG + Intronic
1168853504 20:992924-992946 GCAGGCTGTCACGAAGGCTGTGG - Intronic
1169516419 20:6321411-6321433 GCCGGGCGGCAGCGAGGCTGGGG - Intergenic
1169832352 20:9838768-9838790 GCCGGCTGTCAGCGAAGCGGCGG + Exonic
1174256109 20:49256545-49256567 TCTGGCCGTCACTGAGTCTGAGG + Intronic
1179879357 21:44287015-44287037 CCCGGCCGTCCCCAAGGCTTTGG + Exonic
1182576494 22:31276623-31276645 GGCGGGCGTCACGGAGGCGGCGG + Intronic
1183490194 22:38111812-38111834 GCAGGCCCTCAGGGAGGCTGGGG + Exonic
1185397701 22:50601085-50601107 CCCGGGGGTCACTGAGGCTGGGG - Intronic
1203324511 22_KI270738v1_random:1039-1061 GCAGGGCGGCAGCGAGGCTGGGG - Intergenic
949666118 3:6341232-6341254 GCAAGGCGTCAGCGAGGCTGGGG + Intergenic
950554027 3:13684447-13684469 GCCGGCAGTCCCGGAGGGTGGGG + Intergenic
951055097 3:18138441-18138463 GCTGGCCGTGACTGAGGCTAAGG - Intronic
952327410 3:32334007-32334029 TCCCTCTGTCACCGAGGCTGGGG + Intronic
956866484 3:73374179-73374201 GCAGGGCGGCAGCGAGGCTGGGG - Intergenic
967149856 3:186638563-186638585 GCTGGCCTTCTCCTAGGCTGTGG - Intronic
968520175 4:1031556-1031578 CCCTGCCGTGACCCAGGCTGAGG - Intergenic
968918999 4:3512871-3512893 GCCCGCCGTCAGGGTGGCTGGGG - Exonic
969261525 4:6037152-6037174 GCCCTCCATCACCGAGGCAGAGG + Intronic
969261532 4:6037185-6037207 GCCCTCCATCACCGAGGCAGAGG + Intronic
969261568 4:6037353-6037375 GCCCTCCATCACCGAGGCAGAGG + Intronic
969261619 4:6037588-6037610 GCCCTCCATCACCGAGGCAGAGG + Intronic
969261635 4:6037655-6037677 GCCCTCCATCACCGAGGCAGAGG + Intronic
969261649 4:6037722-6037744 GCCCTCCATCACCGAGGCAGAGG + Intronic
969261662 4:6037789-6037811 GCCCTCCATCACCGAGGCAGAGG + Intronic
969261670 4:6037822-6037844 GCCCTCCATCACCGAGGCAGAGG + Intronic
969261697 4:6037956-6037978 GCCCTCCATCACCGAGGCAGAGG + Intronic
969261746 4:6038191-6038213 GCCCTCCATCACCGAGGCAGAGG + Intronic
969261753 4:6038224-6038246 GCCCTCCATCACCGAGGCAGAGG + Intronic
969261784 4:6038359-6038381 GCCCTCCGTCACTGAGGCAGAGG + Intronic
969261798 4:6038427-6038449 GCCCTCCATCACCGAGGCAGAGG + Intronic
970206941 4:13664822-13664844 GCAGGGCGGCAGCGAGGCTGGGG - Intergenic
972437106 4:39044934-39044956 GCCGGCCGGCGCCGGGGATGAGG + Intergenic
976170888 4:82303259-82303281 GCAGGGCGGCAGCGAGGCTGGGG - Intergenic
976289037 4:83398320-83398342 GCAGGGCGGCAGCGAGGCTGGGG + Intergenic
979318958 4:119300716-119300738 GCCAGCGGTCACGGAGGCAGCGG - Exonic
982361138 4:154520436-154520458 GACGGAGGTCACCCAGGCTGGGG + Intergenic
985451763 4:190066803-190066825 GCCGGCCGGCGCGGCGGCTGTGG - Intergenic
985452751 4:190070095-190070117 GCCGGCCGGCGCGGCGGCTGTGG - Intergenic
985453737 4:190073388-190073410 GCCGGCCGGCGCGGCGGCTGTGG - Intergenic
985454726 4:190076681-190076703 GCCGGCCGGCGCGGCGGCTGTGG - Intergenic
985455716 4:190079978-190080000 GCCGGCCGGCGCGGCGGCTGTGG - Intergenic
985456699 4:190083272-190083294 GCCGGCCGGCGCGGCGGCTGTGG - Intergenic
985457686 4:190086568-190086590 GCCGGCCGGCGCGGCGGCTGTGG - Intergenic
985458674 4:190089865-190089887 GCCGGCCGGCGCGGCGGCTGTGG - Intergenic
985459663 4:190093165-190093187 GCCGGCCGGCGCGGCGGCTGTGG - Intergenic
988177226 5:27743470-27743492 GCCGGCGGGAACCGCGGCTGCGG + Intergenic
990977553 5:61572881-61572903 GCCGGGCGTCTCCCAGGCTCAGG - Intergenic
998119071 5:139561440-139561462 GCCGGCCGAGCCCGAGGCTTGGG + Exonic
999374989 5:151080797-151080819 CCCCGCCGCCACCGAGGCTCTGG + Intronic
999493826 5:152077250-152077272 GCCAGGCGGCAACGAGGCTGGGG + Intergenic
999520412 5:152345618-152345640 GCCAGGCGGCAACGAGGCTGGGG - Intergenic
1002061722 5:176629564-176629586 GCAGGGGGTCACCGAGGCGGCGG - Exonic
1011999618 6:93637175-93637197 GCAGGGCGGCAGCGAGGCTGGGG - Intergenic
1019779128 7:2929443-2929465 GCCGCCCGTTCCCCAGGCTGCGG + Intronic
1020192341 7:6009604-6009626 GCCGGCCGGCACAGATGCCGGGG - Intronic
1020418167 7:7969303-7969325 GCCGGCCGACACGGAGGCGCGGG - Exonic
1023824899 7:44002479-44002501 GCCAGCAGTCTGCGAGGCTGGGG + Intronic
1026088206 7:67279707-67279729 GCCAGCAGTCTGCGAGGCTGGGG + Intergenic
1026088449 7:67281263-67281285 GCCAGCAGTCTGCGAGGCTGGGG + Intergenic
1026745067 7:73005448-73005470 GCCGGCCGGCACAGATGCCGGGG + Intergenic
1026747880 7:73026942-73026964 GCCAGCAGTCTGCGAGGCTGGGG - Intergenic
1026751530 7:73055081-73055103 GCCAGCAGTCTGCGAGGCTGGGG - Intergenic
1026755179 7:73083195-73083217 GCCAGCAGTCTGCGAGGCTGGGG - Intergenic
1026758827 7:73111229-73111251 GCCAGCAGTCTGCGAGGCTGGGG - Intergenic
1027031179 7:74890143-74890165 GCCGGCCGGCACAGATGCCGGGG + Intergenic
1027034086 7:74912236-74912258 GCCAGCAGTCTGCGAGGCTGGGG - Intergenic
1027088577 7:75282257-75282279 GCCAGCAGTCTGCGAGGCTGGGG + Intergenic
1027092220 7:75310185-75310207 GCCAGCAGTCTGCGAGGCTGGGG + Intergenic
1027095863 7:75338152-75338174 GCCAGCAGTCTGCGAGGCTGGGG + Intergenic
1027098673 7:75359632-75359654 GCCGGCCGGCACAGATGCCGGGG - Intergenic
1027118050 7:75496563-75496585 GCCAGCAGTCTGCGAGGCTGGGG + Intergenic
1027323478 7:77029540-77029562 GCCAGCAGTCTGCGAGGCTGGGG - Intergenic
1027327204 7:77057956-77057978 GCCAGCAGTCTGCGAGGCTGAGG - Intergenic
1028459132 7:91071658-91071680 GCCGGCCATCACCACAGCTGCGG + Intronic
1029396636 7:100313029-100313051 GCCAGCAGTCTGCGAGGCTGGGG + Intronic
1029399770 7:100336444-100336466 GCCGGCCGGCACAGATGCCGGGG - Intronic
1029719452 7:102353477-102353499 GCCAGCAGTCTGCGAGGCTGGGG - Intergenic
1029753162 7:102555789-102555811 GCCAGCAGTCTGCGAGGCTGGGG + Intronic
1029771114 7:102654873-102654895 GCCAGCAGTCTGCGAGGCTGGGG + Intronic
1034552709 7:151831817-151831839 GCCTGCCTGCACCGAGGCTGGGG + Intronic
1035341118 7:158162811-158162833 GCAGTCAGTCAACGAGGCTGCGG - Intronic
1036558794 8:9884143-9884165 CTCGGCCGTCACGGGGGCTGTGG + Intergenic
1036664782 8:10731062-10731084 GCCGGCCGGAGCCGGGGCTGGGG + Intronic
1037307355 8:17519551-17519573 GTCAGCCTTCACTGAGGCTGTGG + Intronic
1037879377 8:22565630-22565652 GGCGGGGGTCCCCGAGGCTGGGG - Intronic
1041613193 8:59875393-59875415 GCAAGCCATCAGCGAGGCTGGGG - Intergenic
1041613778 8:59882264-59882286 GCAAGCCATCAGCGAGGCTGGGG + Intergenic
1042040084 8:64580932-64580954 GCCGGGCGTTCCCGAGGCGGCGG - Exonic
1044143674 8:88686118-88686140 GCAGGGCGGCAACGAGGCTGGGG + Intergenic
1047592512 8:126341996-126342018 GCAGGGCGGCAGCGAGGCTGGGG + Intergenic
1049761484 8:144333797-144333819 GGGGGCCGCCGCCGAGGCTGTGG + Exonic
1049815067 8:144595397-144595419 GCCCGCCGTGCCCGAGGCTGGGG + Intronic
1062272323 9:135715086-135715108 GCCAGCCCTCAGCCAGGCTGCGG - Intronic
1062550957 9:137086375-137086397 GCCGGGCGGCACCCGGGCTGGGG - Intergenic
1185599616 X:1329907-1329929 TCCAGCCATCACCCAGGCTGCGG + Intergenic
1185854172 X:3518929-3518951 GCCGGCCTTGGCAGAGGCTGTGG + Intergenic
1185854383 X:3520559-3520581 GCCGGCCTTGGCAGAGGCTGTGG - Intergenic
1191855267 X:65620300-65620322 GCGGGGCGGCAGCGAGGCTGGGG - Intronic
1193123431 X:77847145-77847167 GCAGGGCGGCAGCGAGGCTGGGG - Intronic
1197510350 X:127362635-127362657 GCAAGGCGGCACCGAGGCTGGGG + Intergenic
1202281983 Y:23199132-23199154 GACGGCCGTCCCCCACGCTGTGG + Intergenic
1202283908 Y:23219387-23219409 GACGGCCGTCCCCCACGCTGTGG - Intergenic
1202433655 Y:24813517-24813539 GACGGCCGTCCCCCACGCTGTGG + Intergenic
1202435584 Y:24833773-24833795 GACGGCCGTCCCCCACGCTGTGG - Intergenic