ID: 901635711

View in Genome Browser
Species Human (GRCh38)
Location 1:10669262-10669284
Sequence CCGGCTTAGGGGCCCTAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901635711_901635723 5 Left 901635711 1:10669262-10669284 CCCCATTAGGGCCCCTAAGCCGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 901635723 1:10669290-10669312 GGAAATCCCAGGCCTCTCTGCGG 0: 1
1: 1
2: 3
3: 26
4: 268
901635711_901635719 -6 Left 901635711 1:10669262-10669284 CCCCATTAGGGCCCCTAAGCCGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 901635719 1:10669279-10669301 AGCCGGCCCTAGGAAATCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 67
901635711_901635725 7 Left 901635711 1:10669262-10669284 CCCCATTAGGGCCCCTAAGCCGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 901635725 1:10669292-10669314 AAATCCCAGGCCTCTCTGCGGGG 0: 1
1: 0
2: 1
3: 10
4: 143
901635711_901635724 6 Left 901635711 1:10669262-10669284 CCCCATTAGGGCCCCTAAGCCGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 901635724 1:10669291-10669313 GAAATCCCAGGCCTCTCTGCGGG 0: 1
1: 2
2: 1
3: 23
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901635711 Original CRISPR CCGGCTTAGGGGCCCTAATG GGG (reversed) Intronic
900473104 1:2864087-2864109 CCGGCTCAGGGGACCTCAGGAGG + Intergenic
901635711 1:10669262-10669284 CCGGCTTAGGGGCCCTAATGGGG - Intronic
905274561 1:36808676-36808698 CTGGCTCAGGGTCCCTCATGGGG - Intronic
906076956 1:43058839-43058861 CAGGCTTAGGGGCCCTTTGGAGG + Intergenic
915964745 1:160296602-160296624 CCGGCTTAGGATCTCTCATGAGG - Intronic
920367516 1:205455837-205455859 CCGGGTTGGGGGCCCGAGTGCGG - Intronic
1069781188 10:70956687-70956709 CCTTCTTAGGGGCCCTATGGAGG + Intergenic
1070527934 10:77311281-77311303 CCTGCTGTTGGGCCCTAATGGGG - Intronic
1081705687 11:45180935-45180957 CCGGCTTTGGGGCCCCGGTGGGG + Intronic
1081766076 11:45610929-45610951 CTGGCTCAGGGTCCCTCATGAGG - Intergenic
1082098103 11:48147746-48147768 CTGCCTTAGGGGTCCTCATGCGG + Intronic
1083170565 11:60921942-60921964 CCGGCTTCGTGGCCCTGATGAGG + Exonic
1084536066 11:69757921-69757943 CCGGCTCAGGGGCACTTCTGAGG - Intergenic
1084556406 11:69878767-69878789 CAGGCTGAGGGGGCCCAATGGGG - Intergenic
1085116181 11:73934172-73934194 CCTGCTTCGGGGCCCTATCGGGG + Intergenic
1089897164 11:121942160-121942182 CTGGCTCAGGGTCCCTCATGAGG - Intergenic
1090658130 11:128861315-128861337 CAGGATTGGGGGCCCTAGTGGGG + Intronic
1095987751 12:48010827-48010849 ACAGCTGAGGGGCCCTCATGGGG - Intergenic
1099922859 12:88980723-88980745 CTGGCTTAGGGCCTCTTATGAGG - Intergenic
1099939226 12:89165054-89165076 CTGGCTTAGGGTCTCTCATGAGG - Intergenic
1107860899 13:44660178-44660200 CCGGCTCAGGAACCCCAATGAGG - Intergenic
1115145641 14:30223048-30223070 CCAGCGTAGTGGCCATAATGGGG + Intergenic
1115442886 14:33456346-33456368 CCTGCTTAGCAGCCCTCATGAGG - Intronic
1128267447 15:66279187-66279209 CCTGCTTAGAGGCCCTGATGGGG - Intergenic
1134572138 16:15300227-15300249 CTGGCTTAGGGTCTCCAATGAGG + Intergenic
1134730243 16:16455817-16455839 CTGGCTTAGGGTCTCCAATGAGG - Intergenic
1148191178 17:45679718-45679740 CTGGCTTAGGGTCTCTAATGAGG - Intergenic
1152923166 17:83075993-83076015 CAGGCCTTGGGGCCCTCATGGGG - Intergenic
1157516956 18:48317993-48318015 CCATCTCAGGGGCCCTACTGAGG + Intronic
932752451 2:74379986-74380008 CCGGGTAAGTGGCCCTAATCTGG - Exonic
936154517 2:110039592-110039614 CCGGCTCAGGGACCCCACTGGGG + Intergenic
936190165 2:110331822-110331844 CCGGCTCAGGGACCCCACTGGGG - Intergenic
1171215320 20:23348391-23348413 CAGGCTCAGTGGCCCTAATTGGG + Intergenic
1172356701 20:34285320-34285342 CCCTCTTAGAGGCCCTCATGGGG - Intronic
1172907029 20:38378004-38378026 CAGGCTTTGGGGTCCTCATGGGG + Intergenic
1173354665 20:42276052-42276074 CCAGGGTAGGGGCCATAATGGGG - Intronic
1178888212 21:36498828-36498850 GCCGCTGAGGGGCCCTCATGGGG + Intronic
1179766989 21:43581855-43581877 CCTGCTGAGGGGCCCTGCTGTGG + Intronic
1179767041 21:43582028-43582050 CCTGCTGAGGGGCCCTGTTGTGG + Intronic
950811370 3:15652548-15652570 CCGGCTCAGGGTCTCTCATGAGG - Intergenic
954194882 3:48990573-48990595 CCGGGTGAGGGGACCTAAGGTGG - Exonic
956769480 3:72512524-72512546 CCGGCTCAGGGTCTCTCATGAGG - Intergenic
961773449 3:129267107-129267129 TAGGCCCAGGGGCCCTAATGGGG + Intronic
968985710 4:3873361-3873383 AGGGCTTGGGGGCCCTACTGAGG + Intergenic
975229847 4:71919710-71919732 CTGGCTAAGAGGCCCTAATTTGG + Intergenic
980085939 4:128390076-128390098 ACAGCTTAGGAGCCCTAAGGAGG - Intergenic
984964368 4:185127850-185127872 GCGGCTTCGGGGCCCTGAGGCGG + Intergenic
985130645 4:186735158-186735180 GTGGCTCAGGGGCCCTCATGAGG - Intergenic
1013327096 6:109057153-109057175 CTGGCTCAGGGTCCCTTATGAGG - Intronic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1022688222 7:32616747-32616769 CTGGCTCAGGGTCTCTAATGAGG + Intergenic
1034865179 7:154635666-154635688 CTGGCTCAGGGTCCCTCATGAGG + Intronic
1035055016 7:156029289-156029311 CCAGCTCAGGGGCCCTCTTGGGG + Intergenic
1047821105 8:128521808-128521830 CTGGCTTAGGGGCTCTCATGAGG - Intergenic
1049479055 8:142811349-142811371 CTGGCACAGGGGCCCTCATGGGG - Intergenic
1187309679 X:18129846-18129868 CCGGCTTAGGGTCTCTCACGAGG + Intergenic
1189592929 X:42534610-42534632 CTGGCTTAGGGTCTCTTATGAGG - Intergenic
1195318836 X:103704809-103704831 CCTGCTTGGGGGCTCCAATGGGG + Intergenic