ID: 901636005

View in Genome Browser
Species Human (GRCh38)
Location 1:10670424-10670446
Sequence AGTCAGGGGCGGGCGGCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 278}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901635992_901636005 4 Left 901635992 1:10670397-10670419 CCACAGCCTCCCGCCTAGGCATC 0: 1
1: 0
2: 1
3: 64
4: 528
Right 901636005 1:10670424-10670446 AGTCAGGGGCGGGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 13
4: 278
901635986_901636005 17 Left 901635986 1:10670384-10670406 CCACCTGTGTCCCCCACAGCCTC 0: 1
1: 0
2: 8
3: 79
4: 637
Right 901636005 1:10670424-10670446 AGTCAGGGGCGGGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 13
4: 278
901635987_901636005 14 Left 901635987 1:10670387-10670409 CCTGTGTCCCCCACAGCCTCCCG 0: 1
1: 0
2: 4
3: 42
4: 463
Right 901636005 1:10670424-10670446 AGTCAGGGGCGGGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 13
4: 278
901635984_901636005 19 Left 901635984 1:10670382-10670404 CCCCACCTGTGTCCCCCACAGCC 0: 1
1: 0
2: 7
3: 93
4: 656
Right 901636005 1:10670424-10670446 AGTCAGGGGCGGGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 13
4: 278
901635999_901636005 -9 Left 901635999 1:10670410-10670432 CCTAGGCATCCTGGAGTCAGGGG 0: 1
1: 0
2: 2
3: 36
4: 375
Right 901636005 1:10670424-10670446 AGTCAGGGGCGGGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 13
4: 278
901635985_901636005 18 Left 901635985 1:10670383-10670405 CCCACCTGTGTCCCCCACAGCCT 0: 1
1: 0
2: 6
3: 56
4: 520
Right 901636005 1:10670424-10670446 AGTCAGGGGCGGGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 13
4: 278
901635996_901636005 -6 Left 901635996 1:10670407-10670429 CCGCCTAGGCATCCTGGAGTCAG 0: 1
1: 0
2: 1
3: 21
4: 163
Right 901636005 1:10670424-10670446 AGTCAGGGGCGGGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 13
4: 278
901635989_901636005 7 Left 901635989 1:10670394-10670416 CCCCCACAGCCTCCCGCCTAGGC 0: 1
1: 0
2: 6
3: 49
4: 974
Right 901636005 1:10670424-10670446 AGTCAGGGGCGGGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 13
4: 278
901635994_901636005 -2 Left 901635994 1:10670403-10670425 CCTCCCGCCTAGGCATCCTGGAG 0: 1
1: 0
2: 10
3: 457
4: 6854
Right 901636005 1:10670424-10670446 AGTCAGGGGCGGGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 13
4: 278
901635990_901636005 6 Left 901635990 1:10670395-10670417 CCCCACAGCCTCCCGCCTAGGCA 0: 1
1: 0
2: 2
3: 19
4: 251
Right 901636005 1:10670424-10670446 AGTCAGGGGCGGGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 13
4: 278
901635995_901636005 -5 Left 901635995 1:10670406-10670428 CCCGCCTAGGCATCCTGGAGTCA 0: 1
1: 0
2: 1
3: 26
4: 376
Right 901636005 1:10670424-10670446 AGTCAGGGGCGGGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 13
4: 278
901635991_901636005 5 Left 901635991 1:10670396-10670418 CCCACAGCCTCCCGCCTAGGCAT 0: 1
1: 0
2: 0
3: 20
4: 128
Right 901636005 1:10670424-10670446 AGTCAGGGGCGGGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 13
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901636005 Original CRISPR AGTCAGGGGCGGGCGGCTGC CGG Intronic
900165728 1:1243626-1243648 AGTGAGGGGCTGTCGGTTGCAGG - Intronic
900253721 1:1685514-1685536 AGTGAGGTGGGGGCGGCTCCAGG + Intronic
900256103 1:1699035-1699057 AGGCTGGGCCAGGCGGCTGCGGG + Intronic
900264771 1:1751645-1751667 AGGCTGGGCCAGGCGGCTGCGGG + Exonic
900400020 1:2469220-2469242 GGACAGGGGCTGGCTGCTGCCGG + Intronic
900997560 1:6130673-6130695 AGCCAGGGGTGGGAAGCTGCGGG - Intronic
901636005 1:10670424-10670446 AGTCAGGGGCGGGCGGCTGCCGG + Intronic
901756076 1:11442361-11442383 AGCCAGGGTCGGGTGACTGCTGG + Intergenic
903241212 1:21983875-21983897 AGACAGGGCCTGGGGGCTGCAGG + Intronic
903244718 1:22007059-22007081 AGACAGGGCCTGGGGGCTGCAGG + Intronic
903459379 1:23509844-23509866 AGTCGGGGGCAGGCTGCTGGGGG + Exonic
903517941 1:23925024-23925046 AGTAAGGGGAGGGGGGCTTCTGG - Intergenic
903594761 1:24485626-24485648 TGTCAGGGGTGGGGGGCTGGGGG - Intergenic
905551618 1:38845471-38845493 TGTCAGGGGTGGGTGGCTGGGGG + Intronic
905884471 1:41484418-41484440 AGACAGGGGCGGGAGCCTGGCGG - Intronic
907443125 1:54490543-54490565 AGGGAGGGAGGGGCGGCTGCAGG - Intergenic
907450353 1:54542290-54542312 AGCCAGAGGCGGGAAGCTGCGGG - Intronic
909957982 1:81801982-81802004 AGCCAGCGCCGGGCGGCTCCTGG - Intronic
911217424 1:95210831-95210853 TGTCAGGGGTGGGGGGCTGGGGG - Intronic
916256290 1:162790919-162790941 AGCCAGGGGCGGGCGCTTCCGGG - Intronic
917968528 1:180193393-180193415 AGGCAGGTGTGGGCTGCTGCGGG + Intronic
918056030 1:181022758-181022780 ACTAAGGCGCGGGCAGCTGCGGG - Exonic
918789874 1:188812828-188812850 TGTCAGGGGAGGGCAGCTGGGGG + Intergenic
920039278 1:203085363-203085385 AGACAGGGTCGAGGGGCTGCAGG - Intronic
921945080 1:220880453-220880475 GGTCTTGGGCGGGAGGCTGCAGG + Intronic
923339615 1:232996252-232996274 AGTCAGGGGGGTGTGGCTGCGGG - Intronic
924416723 1:243863629-243863651 AGTCAGGGGTGGGAGTCTGAAGG - Intergenic
1062815862 10:499586-499608 AGCCAAGGGCTGGTGGCTGCAGG + Intronic
1062815996 10:500296-500318 AGCCAAGGGCTGGTGGCTGCAGG - Intronic
1063995052 10:11611395-11611417 CGTGAGGGGCCGGCGGCGGCGGG - Intronic
1065022327 10:21510389-21510411 GGTCAGTGGCCGGGGGCTGCTGG - Intergenic
1066722752 10:38356572-38356594 AGCCAGGGGCGGGCGCTTCCGGG - Intergenic
1067069074 10:43119450-43119472 AGCCAGGGGTGGGAGGCCGCAGG - Intronic
1067167687 10:43878570-43878592 CGACAGGGGCAGGAGGCTGCGGG - Intergenic
1067546773 10:47197489-47197511 TGTCAGGGGCTGGGGGCTGGGGG - Intergenic
1069676836 10:70254816-70254838 AGGCAGTGGTGGGCAGCTGCTGG - Exonic
1070051676 10:72895635-72895657 ATTCAGGGGCGGCTGTCTGCCGG + Intronic
1071562123 10:86652743-86652765 AGCCATGGGCTGGCAGCTGCAGG + Intergenic
1073457604 10:103647049-103647071 AGTCAGGGGTGGGGGGATGGAGG + Intronic
1074088365 10:110225928-110225950 AGGCAGGGGCGGGAGGGGGCGGG + Intronic
1076121464 10:127940084-127940106 AGCCAGGTGCGGGCAGGTGCAGG + Intronic
1076555189 10:131316835-131316857 ATTTTGGGGCTGGCGGCTGCTGG - Intergenic
1076888586 10:133273551-133273573 AGTCACCTGCGGGGGGCTGCTGG - Intronic
1077106104 11:843265-843287 AGCCCGGGGCGGGGAGCTGCCGG - Intronic
1077248032 11:1548566-1548588 AGTCAGGGGCAGGCTTCGGCCGG + Intergenic
1077368363 11:2170399-2170421 AGCCAGGAGCGGGCGCCTGCGGG - Intronic
1083246278 11:61430205-61430227 CGTCCGGGGCGGGCGGCAGCGGG + Intronic
1083932312 11:65852795-65852817 AGGCTGGGGCTGGGGGCTGCGGG - Intronic
1084404012 11:68960673-68960695 AGGCAGGGGTGGGCGGCTCAGGG + Intergenic
1085126522 11:74006062-74006084 AGCCAGGGGCGGGGGGAAGCTGG - Intronic
1087762001 11:102111254-102111276 GGTCAGGGGAGGGGGGTTGCGGG + Intronic
1092159853 12:6310397-6310419 AGTAAGGGGCGGGGCGCCGCCGG - Intergenic
1092256213 12:6928007-6928029 AGGCGGGCGCGGGCGGCGGCGGG + Intronic
1093148962 12:15599660-15599682 AGTCAGGGGTGGAAGTCTGCAGG - Intergenic
1096101475 12:48972701-48972723 TGGCAGGGGCGGGGGGCGGCTGG - Intergenic
1096466325 12:51849011-51849033 AGCCAGGGGCGGGAGGGGGCGGG - Intergenic
1096675150 12:53222013-53222035 GGGGAGGGGCGGGGGGCTGCCGG + Intronic
1096983609 12:55743117-55743139 CGGCCGGGGCGGGCGGCTGGGGG - Intergenic
1097185782 12:57195595-57195617 AGTGAGGGACGGTCGGCCGCTGG + Intronic
1101864236 12:108508289-108508311 AGCCAGGGTCTGGGGGCTGCTGG - Intergenic
1103308882 12:119989183-119989205 AGCCCGGGGCGGGGCGCTGCCGG + Intergenic
1103563336 12:121803848-121803870 AGTGAGGGGTGGGGGGCCGCTGG + Intergenic
1103645114 12:122385686-122385708 AGTCAGTGGATGTCGGCTGCAGG + Intronic
1103703624 12:122860210-122860232 GGTGAGGGGCCGGCGGCAGCAGG + Exonic
1103726748 12:123001006-123001028 AGCCTGGGGAGGGCGGTTGCAGG - Intronic
1104402796 12:128490497-128490519 AGTGAGGGGCAGGAGACTGCTGG + Intronic
1104736729 12:131139707-131139729 AGTCAGGCGCAGGCAGCTGGGGG + Exonic
1104766423 12:131333166-131333188 TGTCAGCGTCGGGAGGCTGCAGG + Intergenic
1105405468 13:20128748-20128770 AGTCAGGTGCGGGCAGGTCCCGG - Intergenic
1108676023 13:52738934-52738956 GGCGAGGGGCGCGCGGCTGCCGG - Intronic
1110436312 13:75481543-75481565 AGCCCGAGGCGGGCGGCTGCGGG - Exonic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1113735034 13:112672440-112672462 AGTAAGGGGCGAGTGGCTGTTGG + Intronic
1113909530 13:113835686-113835708 GGGCTGGGGCAGGCGGCTGCAGG + Intronic
1117912584 14:60649247-60649269 AGGCAGGGGGCGGCGGCCGCAGG + Exonic
1119644386 14:76337959-76337981 AATCAGAGACAGGCGGCTGCAGG - Intronic
1122075821 14:99233875-99233897 AGGCAGGGGAGGGGGGCAGCCGG + Intronic
1122403375 14:101480885-101480907 GCTCAGGGGCGGGGGGCTCCGGG + Intergenic
1122888100 14:104719485-104719507 AGTGAGGGGGCAGCGGCTGCTGG - Exonic
1122982526 14:105198050-105198072 GGTCAGGGGCTGGGGGCTGAAGG + Intergenic
1122983488 14:105201928-105201950 AGTCAGGGGCGCTAGGCTGGGGG - Intergenic
1123013135 14:105358766-105358788 TGTGAGGGGCGGGCGGCTCATGG + Intronic
1124629219 15:31327503-31327525 GCTCGGGGGCGGGCGGCGGCAGG - Exonic
1125057480 15:35378820-35378842 TGTCAGGGGTGGGGGGCTGGGGG + Intronic
1126196589 15:45938251-45938273 AGGCAGGGGTCAGCGGCTGCAGG + Intergenic
1126709920 15:51443884-51443906 AGTGAGGGGCCTGGGGCTGCAGG + Intergenic
1127453246 15:59136756-59136778 GGTCAGGGGCTGGGGGCTGGGGG - Exonic
1129519390 15:76176380-76176402 ACTCAGGAGGGGGTGGCTGCTGG + Intronic
1130304036 15:82700818-82700840 AGTCTGGGGCAGGGGGCTGCAGG - Intronic
1130963726 15:88682037-88682059 AGTCTGGGGCTGGCGTCAGCTGG + Intergenic
1130986991 15:88851104-88851126 GGTCAGGGGTGGGAGGCTGGGGG - Intronic
1131367618 15:91853572-91853594 TGGCAGCGGCGGGCGGCCGCGGG + Intergenic
1132641430 16:980282-980304 GGACGGGGGCGGGCGGCCGCTGG + Intronic
1133022937 16:2974765-2974787 AGTCAGGGAGGGGCGGAAGCAGG + Intronic
1133034524 16:3027473-3027495 ACTCAGGCGCGGCAGGCTGCTGG - Exonic
1133218509 16:4307810-4307832 AGCCAGGGGCGGGGCGCCGCCGG - Intergenic
1134095353 16:11415136-11415158 AGCCAGGGCCAGGTGGCTGCAGG - Intronic
1134149862 16:11797159-11797181 AGGCGGAGGCGGGCGGCGGCAGG + Intronic
1136220167 16:28823413-28823435 AGGCAGGGGGAGGCGGCCGCTGG - Exonic
1137842046 16:51649790-51649812 AGGCAGGCGAGGGCGTCTGCAGG - Intergenic
1138563152 16:57814120-57814142 AGGCTGGGCAGGGCGGCTGCAGG - Intronic
1141842311 16:86580980-86581002 AGGGAAGAGCGGGCGGCTGCAGG - Exonic
1141884501 16:86882469-86882491 AGGCAGTGGGGGGCGGCTGTGGG + Intergenic
1142009874 16:87708509-87708531 AGGCAGGTGGGGGAGGCTGCGGG + Intronic
1142136358 16:88453579-88453601 AGCCCCGGGCGGGCGGCGGCGGG - Exonic
1142206328 16:88784875-88784897 AGTGGGGGGCGGGCGCCTGGGGG - Intronic
1142974836 17:3637014-3637036 AGGCAGGGGCAGCGGGCTGCCGG + Intronic
1143382143 17:6503231-6503253 AGTGAGGGGTGGGAGGCTGGTGG - Intronic
1145026398 17:19471006-19471028 AGCCTGGGGCCAGCGGCTGCAGG - Intergenic
1145276909 17:21437016-21437038 AGCCTGGGGCCAGCGGCTGCAGG - Intergenic
1145314741 17:21722909-21722931 AGCCTGGGGCCAGCGGCTGCAGG - Intergenic
1145713183 17:26994846-26994868 AGCCTGGGGCCAGCGGCTGCAGG - Intergenic
1145878235 17:28335774-28335796 GCTGAGGGGCAGGCGGCTGCAGG + Exonic
1146232976 17:31130453-31130475 AGGCCAGGGCGGGGGGCTGCTGG + Intronic
1146507627 17:33418948-33418970 TGTCAGGGGTGGGGGGCTGGGGG + Intronic
1147110260 17:38256774-38256796 AGTCGGGGCTGGGCGGCCGCAGG - Intergenic
1147598856 17:41733834-41733856 GGAGAGGGGCGGGGGGCTGCGGG - Intronic
1147882273 17:43661480-43661502 AGACAGGGGCTGGGGGCTGGAGG + Exonic
1148206802 17:45784468-45784490 AGGGACCGGCGGGCGGCTGCGGG - Intronic
1149038668 17:52160439-52160461 TGTCTGGGCTGGGCGGCTGCGGG + Intergenic
1150621558 17:66811741-66811763 AGGCTGGGCTGGGCGGCTGCAGG - Intergenic
1151498351 17:74473245-74473267 AGTCAGGGGCTGAGGGCTGGGGG + Intronic
1151712831 17:75816740-75816762 AGTCAGGGGCAGGGGTCAGCAGG - Intronic
1152238333 17:79149766-79149788 GGACAGGGCAGGGCGGCTGCTGG + Intronic
1152354017 17:79798043-79798065 GGGCAGGGGCAGGTGGCTGCGGG - Intronic
1152378241 17:79929572-79929594 AGACAGGGGCTGGCGGCTGAGGG + Intergenic
1152408772 17:80111758-80111780 AGACAGGGCTGGGCGGGTGCTGG - Intergenic
1152495600 17:80669136-80669158 AGCCAGGGGCTGGGGGCTTCTGG + Intronic
1152596905 17:81242219-81242241 AGGCAGGGGTGGGGGGCAGCCGG - Intergenic
1152638595 17:81440230-81440252 TGTCAGGGGCGGGCAGGTGGCGG + Intronic
1152722538 17:81929958-81929980 AGCCTGGGGCGGGAGGATGCCGG - Intergenic
1152722556 17:81930017-81930039 AGCCTGGGGCGGGAGGATGCCGG - Intergenic
1155392232 18:25349977-25349999 AATCGGGGGCGGGCGGCCGAGGG - Intronic
1157955702 18:52095193-52095215 TGTCAGGGGTGGGGGGCTGGGGG + Intergenic
1158967563 18:62636097-62636119 AGTCAGGGGTGGGCTGGAGCGGG + Intergenic
1160789545 19:917242-917264 AGGGAGTGGCGAGCGGCTGCCGG + Intergenic
1160879654 19:1313604-1313626 ACTCAGGGAGGGGCAGCTGCCGG - Intergenic
1161050993 19:2164077-2164099 AGGGAGGGGCGGGAGGCTGAGGG - Intronic
1161161665 19:2765141-2765163 GGGCAGGGGCGGCCGGGTGCGGG - Intronic
1161233349 19:3186427-3186449 AGGCAGGGGCCGGGGGCTGTGGG - Intronic
1161400642 19:4065317-4065339 AGTCAGGCCCGGGCGGGGGCAGG + Intronic
1161773354 19:6243265-6243287 GGGCAGGGGCCGGGGGCTGCCGG - Intronic
1162242076 19:9363168-9363190 AGGCTGGGGCGGGAAGCTGCAGG - Intronic
1162958764 19:14114058-14114080 AGTCAGGGAGGGGCTGCAGCGGG - Intronic
1163485129 19:17580907-17580929 TGAGAGGGGCAGGCGGCTGCTGG + Intronic
1163614461 19:18318449-18318471 AGGCAGGGGAGGAGGGCTGCGGG + Intronic
1164835248 19:31351465-31351487 AGTCCGAGGCGGGCTGCGGCGGG + Intergenic
1165175875 19:33929394-33929416 AGTCAGGAGCGGGTGACTGGAGG + Intergenic
1165460120 19:35939452-35939474 AGGCAGGGGCCAGCGGCAGCAGG - Exonic
1165763414 19:38335906-38335928 ATCCAGGGGCGGGGGGATGCCGG + Intronic
1165901851 19:39173025-39173047 GGGCACGGGCGGGCGGCGGCGGG - Exonic
1167148358 19:47695404-47695426 ATTCAGGGTCGGGAGGTTGCTGG - Exonic
1167150056 19:47703113-47703135 AATCTGGCGCGGGCGGCTGGAGG - Exonic
927936787 2:27080646-27080668 CCTCAGGGGTGGGCAGCTGCTGG - Intronic
928394306 2:30932002-30932024 AGCCAAGGCTGGGCGGCTGCTGG - Intronic
928983242 2:37157005-37157027 AGAGGGGGCCGGGCGGCTGCAGG - Exonic
931291960 2:60881423-60881445 AGGCAGGGGCGGGGCGCTGGGGG + Intergenic
934638290 2:96010475-96010497 AGTGCGGGGCGGGCGGCGCCGGG - Intergenic
934795363 2:97094935-97094957 AGTGCGGGGCGGGCGGCGCCGGG + Intergenic
935112252 2:100104605-100104627 AGTCGGGGGCGGGGGGCGTCGGG - Intronic
935592547 2:104855587-104855609 CGGCAGGGGCTGGCGGCGGCGGG + Exonic
936122730 2:109760554-109760576 AGTCGGGGGCGGGGGGCGTCGGG + Intergenic
936221963 2:110610919-110610941 AGTCGGGGGCGGGGGGCGTCGGG - Intergenic
944699981 2:202238223-202238245 GGAGAGGGGCGGGCGGCTCCGGG + Intronic
944743788 2:202635809-202635831 AGCAAGGGGGAGGCGGCTGCGGG + Intronic
945306772 2:208266370-208266392 AGGCTGGGGCGGGGGGCAGCCGG + Exonic
947941005 2:234054826-234054848 AGTCAGGGCAGGGAGGATGCGGG + Intronic
948945742 2:241218056-241218078 GGGCAGGGGCGGGGGGCAGCGGG + Intronic
1170774552 20:19364265-19364287 ACTCAGGGGAGGGGGGCGGCTGG - Intronic
1171307464 20:24118610-24118632 AGCCATGGGCGGGCTGCTGCCGG + Intergenic
1172288967 20:33761623-33761645 GGTCAGAGGAGGGCGGCTCCAGG + Intronic
1173454277 20:43190418-43190440 AAGCTGGGGCAGGCGGCTGCTGG + Intergenic
1176286252 21:5020910-5020932 GCCCCGGGGCGGGCGGCTGCTGG - Intergenic
1177788300 21:25695663-25695685 AGACGGGGCGGGGCGGCTGCCGG + Intronic
1178581090 21:33839330-33839352 GGCCAGGGGAGGGTGGCTGCAGG + Intronic
1179533062 21:42033142-42033164 AGCCAGGGGCAGGTGGGTGCTGG + Intergenic
1179870929 21:44242565-44242587 GCCCCGGGGCGGGCGGCTGCTGG + Intergenic
1180092111 21:45538528-45538550 GGCCAGCGGCGGGTGGCTGCAGG + Intronic
1180959346 22:19755606-19755628 AGAGAAGGGCGGGCGGCTGGGGG - Intergenic
1181462796 22:23095271-23095293 AGCCGGAGGCGGGGGGCTGCAGG + Exonic
1182603937 22:31489389-31489411 ACTGAGGGGCGGCCGGCCGCAGG + Exonic
1183309398 22:37101292-37101314 AGACAGGGGCAGGCGGGTGCTGG + Intronic
1183315776 22:37136172-37136194 AGGCAGGAGGGGGCGGCTGGAGG - Intronic
1183354329 22:37350388-37350410 AGACACTGTCGGGCGGCTGCAGG + Intergenic
1183546307 22:38456075-38456097 GGGCTGGGGCGGGGGGCTGCTGG + Intergenic
1183713660 22:39521077-39521099 AGTCAAGGGCGGGCGGTGGGCGG + Exonic
1183862791 22:40681708-40681730 GGTGAGGGTCGGGCGGCTGATGG - Exonic
1184236866 22:43187352-43187374 CGGCAGGGGCGGGGGGCTGGGGG - Intergenic
1184453635 22:44597196-44597218 GGGCAGGGGCAGGAGGCTGCAGG + Intergenic
1184640561 22:45867914-45867936 AGTCTGGGGCAGGGGGCTTCCGG - Intergenic
1184974337 22:48050424-48050446 GGTCAGGGACGGGCAGATGCTGG + Intergenic
1185088915 22:48755269-48755291 AGGCTGGGGCTGGGGGCTGCTGG - Intronic
1185206420 22:49541556-49541578 AGCGAGGGGAGGGCGGCTCCTGG + Intronic
950486626 3:13277865-13277887 GGCCAGGGGCGGGGGGCTGAGGG - Intergenic
950614841 3:14150232-14150254 AGGCATGGGCGTGCGGCTGAGGG + Intronic
951217724 3:20040494-20040516 GGGCCGGGCCGGGCGGCTGCGGG + Exonic
952834151 3:37590006-37590028 TGTTAGGGGATGGCGGCTGCAGG - Intronic
961358130 3:126351705-126351727 AGGGAGGGGCAGGCGGGTGCAGG - Intronic
961754913 3:129121825-129121847 AGCCGGGGGCGGGCGGGGGCGGG - Intronic
962416936 3:135191868-135191890 AGTCATTGGCTGGGGGCTGCTGG - Intronic
967980358 3:195061708-195061730 GGTCATGGGCAGGCGGCTTCAGG - Intergenic
968384677 4:125388-125410 AGGCAGGGACTGGCGTCTGCAGG + Intronic
968393686 4:213526-213548 AGGCAGGGACTGGCGTCTGCAGG + Intergenic
968405899 4:338704-338726 AGGCAGGGACTGGCGTCTGCAGG + Intronic
968890220 4:3364847-3364869 AGCCAGGGCCTGGCTGCTGCAGG + Intronic
969232988 4:5844712-5844734 ACTCAGGAGCTGGGGGCTGCAGG + Intronic
969273022 4:6115830-6115852 AGGCAGGATGGGGCGGCTGCAGG + Intronic
969557730 4:7924707-7924729 TGTCCTGGGCGGGCAGCTGCAGG - Intronic
969602354 4:8183772-8183794 AGTCAGGTGTGGGCTGCAGCTGG - Intronic
974942830 4:68489536-68489558 AGTCAGTGGCTGGAGGCTGCAGG + Intronic
976798628 4:88962515-88962537 AGTAAGGGGTGGTCAGCTGCAGG + Intronic
977002489 4:91521030-91521052 TGTCAGGGGCGGGGGTCTGGGGG - Intronic
982094396 4:151908408-151908430 AATGAGGAGCGGGCTGCTGCAGG + Intergenic
982281029 4:153684077-153684099 GGTCAAGGGCGGGAGCCTGCTGG + Intergenic
982712186 4:158768885-158768907 AGCCCGGGGCGGGCGGCCGCCGG + Intergenic
984973419 4:185209910-185209932 CTTCAGGGGCGAGCGGCGGCCGG + Intronic
985588174 5:751465-751487 AGGCAGGGGCGGGGGCATGCAGG + Intronic
985602844 5:843928-843950 AGGCAGGGGCGGGGGCATGCAGG + Intronic
985628909 5:1004910-1004932 GGTCAGAAGCGGGCGGCGGCGGG - Intergenic
985813009 5:2103945-2103967 AGTCAGGTGAGCGCGGGTGCAGG - Intergenic
986027510 5:3864728-3864750 ACTCAGGGAGGGGCTGCTGCGGG + Intergenic
987391063 5:17375884-17375906 TGTCAGGGGTGGGGGGCTGGGGG - Intergenic
989408604 5:41091103-41091125 TGTCAGGGGTGGGTGGCTGGGGG + Intergenic
990277723 5:54215788-54215810 AGTCAGGGGTGGGGGGCTGGGGG + Intronic
995032285 5:107494255-107494277 CGTGAGCTGCGGGCGGCTGCGGG + Intronic
997976771 5:138445629-138445651 AGGCAGGGGGTGGCGGCTCCAGG + Intronic
998083220 5:139293826-139293848 AGTCGGGGTCGGGTGGCTGGGGG + Intronic
1002160587 5:177312025-177312047 ACTCGGGGCGGGGCGGCTGCCGG - Exonic
1002457101 5:179351388-179351410 AGTCAGAAGGGGGCGGCTCCAGG + Intergenic
1002817330 6:693090-693112 AGTGAGGTGCCGGCGGCTGGCGG - Exonic
1003166124 6:3680004-3680026 AGACAAGGGCTGGCAGCTGCAGG + Intergenic
1003833417 6:10040473-10040495 AGTCAGCGGTGGCAGGCTGCTGG + Intronic
1005683032 6:28225482-28225504 GGTCAGTGCCGGGCGGCTTCGGG + Intronic
1006717867 6:36131446-36131468 AGTCAGGGGCAGGCGCAGGCGGG + Intronic
1007072841 6:39049191-39049213 AGTCAGCGCAGGGCGGCCGCGGG - Intronic
1007533589 6:42564474-42564496 AGTCTGGGTCGGGCTGCTCCAGG - Intronic
1007665399 6:43510301-43510323 AGCCTGAGGCGGGCGGCTGGCGG + Exonic
1007784107 6:44270566-44270588 AGTAAGGGGCTGGGGGCTGAGGG - Exonic
1011194045 6:84764191-84764213 AGAGAGGGGCGGGCGGGCGCGGG - Exonic
1011448990 6:87473048-87473070 AGTCCGCGGGGGGCGGCGGCGGG + Intronic
1014215693 6:118750749-118750771 AGTCAGTGGCGTGCAGCAGCTGG + Intergenic
1017954563 6:159167982-159168004 AGGCAGAGCCGGGTGGCTGCTGG + Intergenic
1018866111 6:167748165-167748187 AGTCAGGAGTGGGCAGTTGCTGG - Intergenic
1018978202 6:168581784-168581806 AGGGAGGGGAGGGGGGCTGCAGG - Intronic
1019188509 6:170235981-170236003 AGCCAGGGGAGGGCCGCTGGGGG + Intergenic
1019828523 7:3302350-3302372 AGTCAGGAGCAGGCGGGGGCTGG - Intronic
1020034886 7:4958915-4958937 AGGGAGGGGCGCGCGGCGGCGGG - Intronic
1023872747 7:44271675-44271697 AGTCAGAGGAGAGGGGCTGCTGG - Intronic
1024480340 7:49855799-49855821 AGCCAGGGGCCGGTGGCTGACGG + Intronic
1026737730 7:72959841-72959863 AGCCAGGGTCTGGTGGCTGCGGG - Exonic
1026788765 7:73318642-73318664 AGCCAGGGTCTGGTGGCTGCGGG - Intronic
1026837374 7:73647810-73647832 GGCCAGGGGCGGGCGGCGGGCGG + Intergenic
1027106004 7:75405227-75405249 AGCCAGGGTCTGGTGGCTGCGGG + Exonic
1027774186 7:82443953-82443975 AGTCAGAGGGAGGCGGCTGGGGG + Intergenic
1029292436 7:99512514-99512536 GGTCAGGGGATGGGGGCTGCAGG - Exonic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1033361288 7:140640583-140640605 GCTCGGGGGCGGGCGGCGGCGGG + Exonic
1036398244 8:8386539-8386561 AGGCGGGGCCGGGCGGCGGCAGG - Intergenic
1037006808 8:13791565-13791587 AGTCAGGGGAGGTAGGCTGAGGG - Intergenic
1040480885 8:47825297-47825319 AGGCCGGGGCGGGCGGATCCTGG + Intronic
1041634223 8:60124815-60124837 TGTCAGGGTTGGGCGGCTGGGGG - Intergenic
1042561157 8:70072558-70072580 CGTCGGGGGCGGGCGGGCGCGGG - Intergenic
1042859038 8:73295008-73295030 CGGGACGGGCGGGCGGCTGCCGG + Exonic
1044734955 8:95269359-95269381 CGTGAGGGGCGGGCGTATGCAGG + Intergenic
1044824917 8:96186588-96186610 AGTCAAGGGTTGGCAGCTGCCGG + Intergenic
1045904790 8:107331995-107332017 AGTCAGAGATGGGCGGGTGCTGG + Intronic
1049364914 8:142232474-142232496 AATGAGGGGAGGGCGGCCGCAGG + Intronic
1049607707 8:143537397-143537419 GGGCAGGGGCCGGGGGCTGCTGG - Intronic
1049641650 8:143718730-143718752 AGTCGGGGGTGGGGGGCTGGGGG - Intronic
1050639704 9:7654421-7654443 AACCTGGGGCGGGGGGCTGCTGG - Intergenic
1052807539 9:33025743-33025765 AGGCAGGGGCGAGGGGCTGCGGG + Intronic
1053181260 9:35972276-35972298 GGGGAGCGGCGGGCGGCTGCTGG + Intergenic
1053424100 9:37999877-37999899 AGTCATGAGCTGGAGGCTGCAGG - Intronic
1057215344 9:93224803-93224825 AGTCAGAGGCGGGGGCCTCCTGG - Intronic
1057276162 9:93676986-93677008 AGGCAGGGCAGGGGGGCTGCAGG - Intronic
1058912567 9:109534290-109534312 GGCAAGCGGCGGGCGGCTGCTGG + Intergenic
1059456496 9:114403235-114403257 AGGCAGGGGCTGGCGGGTGTTGG + Exonic
1059470936 9:114504718-114504740 CGGCCGGGGCGGGCGGCGGCGGG - Exonic
1059965127 9:119606251-119606273 TGTCAGGGGTGGGGGGCTGGGGG - Intergenic
1060548733 9:124475491-124475513 AGTCTGGGGGTGCCGGCTGCAGG + Intronic
1060970537 9:127735076-127735098 AGCGAGGGGCGGGCGGACGCGGG - Intronic
1061083385 9:128385582-128385604 AGTCAGGGGCTGGTGGCTTGGGG - Intronic
1061803179 9:133123249-133123271 AGTCAGTGGCAGGCAGCTTCTGG - Intronic
1061806667 9:133140873-133140895 AGACAGTGGCGGGGAGCTGCCGG - Intronic
1061920831 9:133781482-133781504 GGTCAGGGGTGGGGGGCAGCTGG + Intronic
1062177919 9:135174598-135174620 AGTCAGGGGCCAGCGGCAGAGGG - Intergenic
1062538205 9:137030098-137030120 TGTCAGGGGAGGGCAGATGCAGG + Intronic
1062547253 9:137069384-137069406 AGGCAGGCGGGGGCTGCTGCTGG - Intronic
1195210744 X:102651179-102651201 TGGCACCGGCGGGCGGCTGCGGG - Intergenic
1199672112 X:150156017-150156039 AGCCAGGGGCTGGGGGCTGAGGG - Intergenic
1199772411 X:150983496-150983518 AGGCAGGGGGAGGCGGCGGCAGG - Intronic
1200081658 X:153579848-153579870 AGTCAGTGGCCGGCTGGTGCTGG - Intronic