ID: 901641432

View in Genome Browser
Species Human (GRCh38)
Location 1:10694887-10694909
Sequence AGCGCGCGCGCGGCCGCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 0, 3: 47, 4: 256}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901641432_901641436 1 Left 901641432 1:10694887-10694909 CCGCCGGCGGCCGCGCGCGCGCT 0: 1
1: 0
2: 0
3: 47
4: 256
Right 901641436 1:10694911-10694933 GCATGCTGCCAGCGGCCGCTCGG 0: 1
1: 0
2: 1
3: 15
4: 159
901641432_901641440 23 Left 901641432 1:10694887-10694909 CCGCCGGCGGCCGCGCGCGCGCT 0: 1
1: 0
2: 0
3: 47
4: 256
Right 901641440 1:10694933-10694955 GGCCCCGCGAGCGCGACCGACGG 0: 1
1: 0
2: 1
3: 0
4: 40
901641432_901641437 2 Left 901641432 1:10694887-10694909 CCGCCGGCGGCCGCGCGCGCGCT 0: 1
1: 0
2: 0
3: 47
4: 256
Right 901641437 1:10694912-10694934 CATGCTGCCAGCGGCCGCTCGGG 0: 1
1: 0
2: 0
3: 12
4: 120
901641432_901641435 -7 Left 901641432 1:10694887-10694909 CCGCCGGCGGCCGCGCGCGCGCT 0: 1
1: 0
2: 0
3: 47
4: 256
Right 901641435 1:10694903-10694925 GCGCGCTCGCATGCTGCCAGCGG 0: 1
1: 0
2: 0
3: 2
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901641432 Original CRISPR AGCGCGCGCGCGGCCGCCGG CGG (reversed) Intronic