ID: 901641434 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:10694897-10694919 |
| Sequence | GCAGCATGCGAGCGCGCGCG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 65 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 4, 4: 60} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 901641434_901641436 | -9 | Left | 901641434 | 1:10694897-10694919 | CCGCGCGCGCGCTCGCATGCTGC | 0: 1 1: 0 2: 0 3: 4 4: 60 |
||
| Right | 901641436 | 1:10694911-10694933 | GCATGCTGCCAGCGGCCGCTCGG | 0: 1 1: 0 2: 1 3: 15 4: 159 |
||||
| 901641434_901641440 | 13 | Left | 901641434 | 1:10694897-10694919 | CCGCGCGCGCGCTCGCATGCTGC | 0: 1 1: 0 2: 0 3: 4 4: 60 |
||
| Right | 901641440 | 1:10694933-10694955 | GGCCCCGCGAGCGCGACCGACGG | 0: 1 1: 0 2: 1 3: 0 4: 40 |
||||
| 901641434_901641437 | -8 | Left | 901641434 | 1:10694897-10694919 | CCGCGCGCGCGCTCGCATGCTGC | 0: 1 1: 0 2: 0 3: 4 4: 60 |
||
| Right | 901641437 | 1:10694912-10694934 | CATGCTGCCAGCGGCCGCTCGGG | 0: 1 1: 0 2: 0 3: 12 4: 120 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 901641434 | Original CRISPR | GCAGCATGCGAGCGCGCGCG CGG (reversed) | Intronic | ||