ID: 901641434

View in Genome Browser
Species Human (GRCh38)
Location 1:10694897-10694919
Sequence GCAGCATGCGAGCGCGCGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901641434_901641436 -9 Left 901641434 1:10694897-10694919 CCGCGCGCGCGCTCGCATGCTGC 0: 1
1: 0
2: 0
3: 4
4: 60
Right 901641436 1:10694911-10694933 GCATGCTGCCAGCGGCCGCTCGG 0: 1
1: 0
2: 1
3: 15
4: 159
901641434_901641440 13 Left 901641434 1:10694897-10694919 CCGCGCGCGCGCTCGCATGCTGC 0: 1
1: 0
2: 0
3: 4
4: 60
Right 901641440 1:10694933-10694955 GGCCCCGCGAGCGCGACCGACGG 0: 1
1: 0
2: 1
3: 0
4: 40
901641434_901641437 -8 Left 901641434 1:10694897-10694919 CCGCGCGCGCGCTCGCATGCTGC 0: 1
1: 0
2: 0
3: 4
4: 60
Right 901641437 1:10694912-10694934 CATGCTGCCAGCGGCCGCTCGGG 0: 1
1: 0
2: 0
3: 12
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901641434 Original CRISPR GCAGCATGCGAGCGCGCGCG CGG (reversed) Intronic