ID: 901641438

View in Genome Browser
Species Human (GRCh38)
Location 1:10694919-10694941
Sequence CGCGGGGCCCGAGCGGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 335}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901641438_901641447 24 Left 901641438 1:10694919-10694941 CCAGCGGCCGCTCGGGCCCCGCG 0: 1
1: 0
2: 2
3: 48
4: 335
Right 901641447 1:10694966-10694988 CGCCTGCCCCACGACCCGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 88
901641438_901641440 -9 Left 901641438 1:10694919-10694941 CCAGCGGCCGCTCGGGCCCCGCG 0: 1
1: 0
2: 2
3: 48
4: 335
Right 901641440 1:10694933-10694955 GGCCCCGCGAGCGCGACCGACGG 0: 1
1: 0
2: 1
3: 0
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901641438 Original CRISPR CGCGGGGCCCGAGCGGCCGC TGG (reversed) Intronic