ID: 901641440

View in Genome Browser
Species Human (GRCh38)
Location 1:10694933-10694955
Sequence GGCCCCGCGAGCGCGACCGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 40}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901641432_901641440 23 Left 901641432 1:10694887-10694909 CCGCCGGCGGCCGCGCGCGCGCT 0: 1
1: 0
2: 0
3: 47
4: 256
Right 901641440 1:10694933-10694955 GGCCCCGCGAGCGCGACCGACGG 0: 1
1: 0
2: 1
3: 0
4: 40
901641434_901641440 13 Left 901641434 1:10694897-10694919 CCGCGCGCGCGCTCGCATGCTGC 0: 1
1: 0
2: 0
3: 4
4: 60
Right 901641440 1:10694933-10694955 GGCCCCGCGAGCGCGACCGACGG 0: 1
1: 0
2: 1
3: 0
4: 40
901641431_901641440 27 Left 901641431 1:10694883-10694905 CCGGCCGCCGGCGGCCGCGCGCG 0: 1
1: 1
2: 3
3: 74
4: 430
Right 901641440 1:10694933-10694955 GGCCCCGCGAGCGCGACCGACGG 0: 1
1: 0
2: 1
3: 0
4: 40
901641433_901641440 20 Left 901641433 1:10694890-10694912 CCGGCGGCCGCGCGCGCGCTCGC 0: 1
1: 0
2: 14
3: 69
4: 400
Right 901641440 1:10694933-10694955 GGCCCCGCGAGCGCGACCGACGG 0: 1
1: 0
2: 1
3: 0
4: 40
901641438_901641440 -9 Left 901641438 1:10694919-10694941 CCAGCGGCCGCTCGGGCCCCGCG 0: 1
1: 0
2: 2
3: 48
4: 335
Right 901641440 1:10694933-10694955 GGCCCCGCGAGCGCGACCGACGG 0: 1
1: 0
2: 1
3: 0
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901641440 Original CRISPR GGCCCCGCGAGCGCGACCGA CGG Intronic