ID: 901642956

View in Genome Browser
Species Human (GRCh38)
Location 1:10702310-10702332
Sequence GGTCCACAGAGGCCTCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 246}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901642948_901642956 14 Left 901642948 1:10702273-10702295 CCTGCACCCTTTCAAGGAGCGCG 0: 1
1: 0
2: 0
3: 0
4: 38
Right 901642956 1:10702310-10702332 GGTCCACAGAGGCCTCCCACTGG 0: 1
1: 0
2: 2
3: 22
4: 246
901642946_901642956 22 Left 901642946 1:10702265-10702287 CCTATGCACCTGCACCCTTTCAA 0: 1
1: 0
2: 1
3: 13
4: 192
Right 901642956 1:10702310-10702332 GGTCCACAGAGGCCTCCCACTGG 0: 1
1: 0
2: 2
3: 22
4: 246
901642945_901642956 23 Left 901642945 1:10702264-10702286 CCCTATGCACCTGCACCCTTTCA 0: 1
1: 0
2: 1
3: 14
4: 161
Right 901642956 1:10702310-10702332 GGTCCACAGAGGCCTCCCACTGG 0: 1
1: 0
2: 2
3: 22
4: 246
901642950_901642956 7 Left 901642950 1:10702280-10702302 CCTTTCAAGGAGCGCGCCCAGCT 0: 1
1: 0
2: 1
3: 11
4: 35
Right 901642956 1:10702310-10702332 GGTCCACAGAGGCCTCCCACTGG 0: 1
1: 0
2: 2
3: 22
4: 246
901642953_901642956 -10 Left 901642953 1:10702297-10702319 CCAGCTTCCAGAAGGTCCACAGA 0: 1
1: 0
2: 1
3: 21
4: 218
Right 901642956 1:10702310-10702332 GGTCCACAGAGGCCTCCCACTGG 0: 1
1: 0
2: 2
3: 22
4: 246
901642949_901642956 8 Left 901642949 1:10702279-10702301 CCCTTTCAAGGAGCGCGCCCAGC 0: 1
1: 0
2: 0
3: 4
4: 43
Right 901642956 1:10702310-10702332 GGTCCACAGAGGCCTCCCACTGG 0: 1
1: 0
2: 2
3: 22
4: 246
901642952_901642956 -9 Left 901642952 1:10702296-10702318 CCCAGCTTCCAGAAGGTCCACAG 0: 1
1: 0
2: 4
3: 25
4: 217
Right 901642956 1:10702310-10702332 GGTCCACAGAGGCCTCCCACTGG 0: 1
1: 0
2: 2
3: 22
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901642956 Original CRISPR GGTCCACAGAGGCCTCCCAC TGG Intronic
901642956 1:10702310-10702332 GGTCCACAGAGGCCTCCCACTGG + Intronic
902255390 1:15185904-15185926 CGTCCACAGAGACCTCCAAGTGG + Intronic
902414499 1:16230876-16230898 TGTCCTCAATGGCCTCCCACGGG + Intergenic
903479028 1:23639721-23639743 GGTCAGCTGAGGCCTGCCACGGG - Exonic
903579453 1:24359842-24359864 GAAGCACAGAGGCCGCCCACTGG + Intronic
905559000 1:38911352-38911374 GGTCCACAAAGGCCTCCGTGTGG - Exonic
908903921 1:68986085-68986107 GGTCGACAGACACCTCACACAGG + Intergenic
911104476 1:94119038-94119060 AGTCCACAGATGCCTCACATAGG + Intronic
911284545 1:95974352-95974374 GGTCGACAGACGCCTCATACAGG - Intergenic
912389798 1:109295129-109295151 AGTCCACAGATGCCTCCCCTAGG + Exonic
912493967 1:110079474-110079496 GGGCCACAGAGGCCCCACATTGG + Intergenic
915226649 1:154416805-154416827 GGTCAGCATAGGCCTCACACTGG + Intronic
915688524 1:157662342-157662364 GGTCAACAGACACCTCCTACAGG + Intergenic
920197973 1:204242132-204242154 GATCCTCAGAGACCCCCCACCGG - Intronic
922253347 1:223870545-223870567 GGTCAACAGACGCCTCATACAGG - Intergenic
923505720 1:234604874-234604896 CGTCCACAAAGGCCACCCAAAGG + Exonic
924948161 1:248859458-248859480 GGTCCACAGAGGGCTCTAGCTGG - Intergenic
1063914441 10:10867232-10867254 GGTGCACAGTGGGCTCCCCCAGG + Intergenic
1064454237 10:15472083-15472105 GGTGCACAGTGGCCTCCCCTTGG + Intergenic
1065104852 10:22372537-22372559 GGTCCCCAGCAGCCTCCCTCAGG + Intronic
1065611368 10:27474408-27474430 GCTCCATAGAGGCCTCCCAAAGG + Intergenic
1066109969 10:32187142-32187164 AGTCCAGAGAGGTCTCACACAGG - Intergenic
1067212025 10:44267301-44267323 GGTCGACAGATACCTCACACAGG + Intergenic
1067290478 10:44935917-44935939 GGACCACAGAGGCTGCCCAGGGG + Exonic
1071113912 10:82194682-82194704 GGTAGGCAGAGTCCTCCCACCGG - Intronic
1072656464 10:97333911-97333933 GGTCCGCTGCGGCCTCCCCCGGG + Exonic
1073121849 10:101126773-101126795 GATCCAAAGGGGCCTCCCCCTGG + Intronic
1073302037 10:102476735-102476757 GGTGCACACAGGCCTGCCATGGG + Exonic
1075551509 10:123395975-123395997 GGACCACACAGACCTCCTACTGG + Intergenic
1075709232 10:124521774-124521796 GGATGACTGAGGCCTCCCACTGG + Intronic
1075715662 10:124553811-124553833 GCTGCACAGAGACCTCCCCCGGG + Intronic
1076373029 10:129967130-129967152 GGTGCACAGAGCGCTCCCAGGGG + Intergenic
1077120332 11:904543-904565 GAGCCACACAGGCCACCCACCGG + Intronic
1077508924 11:2945314-2945336 GGTCTACAGGGCCCTCCCACAGG + Exonic
1077843794 11:6002815-6002837 GGTGCAGAGAGGCCTCCAGCTGG + Exonic
1077846224 11:6027515-6027537 GGTGCAGAGAGGCCTCCAGCTGG + Exonic
1079030125 11:16980470-16980492 GATCCACAGCCGCCTCCCACAGG + Intronic
1079078106 11:17396104-17396126 GGTCCAGAGAGGGCTTACACAGG + Intronic
1080607680 11:33877178-33877200 GGTTCACAGAGGCCTGGCCCAGG + Intronic
1081695398 11:45105867-45105889 GGGCCACAGAGGCCTCTCCAGGG + Intronic
1085394177 11:76198347-76198369 GGTCCAGGGAGGCTGCCCACAGG - Intronic
1085413582 11:76306087-76306109 GGCCCAGAGAGGCCCCCCAGGGG - Intergenic
1086279819 11:85172173-85172195 GGTCTCCAGACGCCTCCTACAGG + Intronic
1087667868 11:101071046-101071068 GGTCGACAGACACCTCACACAGG + Intronic
1087915969 11:103811141-103811163 CCTCCACAGAGGCTTCCCAATGG + Intergenic
1089349889 11:117816291-117816313 GGGCCACAGCGGCCTCCTTCCGG - Intronic
1090667854 11:128926817-128926839 GGTTCACAGGGGCCTCTCTCAGG - Intergenic
1091074448 11:132602157-132602179 TTTCCACAGAAGCCTCCCAGAGG + Intronic
1091360355 11:134974446-134974468 GTGCCAGAGAAGCCTCCCACTGG + Intergenic
1091905978 12:4189491-4189513 GCTCCTCAGAGGAATCCCACGGG - Intergenic
1096370163 12:51062896-51062918 GCTCCACATAGGCCTCCTATGGG + Exonic
1097526697 12:60746161-60746183 GGTCAAGAGATGCCTCACACAGG + Intergenic
1099744900 12:86689730-86689752 GGTCGACAGACACCTCCTACAGG - Intronic
1103060037 12:117851228-117851250 CCTCCACATAGGCCTCCCTCTGG - Intronic
1103169076 12:118798549-118798571 GGTCAACAGATGCCTCATACAGG - Intergenic
1103919663 12:124392885-124392907 AGACCCCAGAGGCCTCCCCCAGG - Intronic
1106429504 13:29666297-29666319 GGTCTACAGACACCTCACACAGG + Intergenic
1106504633 13:30360516-30360538 GGTCCACAGTGACCTCCTAATGG - Intergenic
1108048730 13:46408484-46408506 GGTCCACAGACACCTCATACAGG - Intronic
1109457422 13:62611168-62611190 GGTCGACAGACACCTCACACAGG - Intergenic
1109541262 13:63781829-63781851 GGTCCACAGACACCTCATACAGG - Intergenic
1111958522 13:94783927-94783949 GGACTACAGACGCCTGCCACCGG + Intergenic
1113748949 13:112765304-112765326 CGTCCTCAGAGGCCTCCCCAAGG - Intronic
1114844967 14:26309636-26309658 GGTCGACAGACACCTCCTACAGG + Intergenic
1116336655 14:43665825-43665847 GATCCACAGAGGCCTCCAGCAGG + Intergenic
1116417220 14:44693642-44693664 GGCCAACAGACGCCTCACACAGG + Intergenic
1116775797 14:49179201-49179223 GGTCCACAGACACCGCACACAGG + Intergenic
1119168600 14:72515816-72515838 GGTCCTCAGGGCCTTCCCACAGG + Intronic
1120153616 14:81065539-81065561 GCTCCACTGAGGCTTCCCCCAGG + Intronic
1120271713 14:82321503-82321525 GGTCAACAGACGCCTCATACAGG - Intergenic
1120522810 14:85544535-85544557 GGTCCTCAGAGGCCTCTATCAGG - Intronic
1122903066 14:104789868-104789890 GGTCCACACAGGCCTGCAGCCGG + Intronic
1127533469 15:59867536-59867558 GATCCAGAGTGGCCTCTCACTGG - Intergenic
1128687262 15:69696018-69696040 GGTCCAGGGAGGCCTAACACAGG - Intergenic
1128925544 15:71651982-71652004 GGTCCCCAGAAGGCTCTCACGGG - Intronic
1129823302 15:78619013-78619035 GTTCCACAGAATCCCCCCACAGG - Intronic
1130017198 15:80196742-80196764 GGTCCACATAGGCAGCACACTGG - Intergenic
1130724100 15:86420189-86420211 GGTCGACAGACACCTCACACAGG + Intronic
1131259210 15:90879930-90879952 GGACCACAGTGGCCCCCCAGCGG + Exonic
1131679939 15:94710699-94710721 TGTCCACCTAGGCCTCCCAGTGG + Intergenic
1132761637 16:1511277-1511299 GGTGCACTGAGGCTTCCCATTGG + Intronic
1133118038 16:3589392-3589414 GGCCAACAGAAGCCCCCCACTGG - Exonic
1133278689 16:4652873-4652895 GGTGGACAGAAGCCTCCCCCAGG - Intronic
1134250775 16:12572394-12572416 GGGCCACAGAGCCCTGCCTCAGG - Exonic
1134449863 16:14356640-14356662 GGTTAACAGAGGCCTCCCCTGGG - Intergenic
1135436332 16:22429034-22429056 AGGCCACAGAGGCCTCCCAGTGG - Intronic
1136171378 16:28491801-28491823 TGTCCAAAGGGGGCTCCCACGGG + Exonic
1137296399 16:47097747-47097769 GGTCGACAGACACCTCACACAGG + Intronic
1138023124 16:53502781-53502803 GGGCCCCAGAGCCCCCCCACTGG - Intronic
1138435929 16:57000095-57000117 GGGCCCCAGAGGCCTCTCCCTGG - Intronic
1139532407 16:67548855-67548877 GCCTCACAGGGGCCTCCCACAGG + Intergenic
1140530327 16:75660288-75660310 GGTCTACACGGGCCTGCCACAGG - Intronic
1141983861 16:87566837-87566859 GTGCCACAGAGGGCTCCCACCGG + Intergenic
1142030215 16:87834837-87834859 CGTCTCCCGAGGCCTCCCACGGG + Intronic
1142045547 16:87922868-87922890 AGGCCACAGAGGCCTCCCAATGG - Intronic
1143163089 17:4884205-4884227 GGGCCACAGAAGCCTCACAAAGG - Intronic
1143328849 17:6119548-6119570 GGCCGGCAGAGGCCACCCACTGG - Intronic
1145032828 17:19518188-19518210 GGTCCACAGTGGCCCCTCACAGG + Intronic
1145248821 17:21286376-21286398 GGCCCACATAGGGCTCCCATTGG - Intronic
1146176660 17:30669474-30669496 GCTCCTCAGAGTCCTCCCACAGG + Intergenic
1146350124 17:32085589-32085611 GCTCCTCAGGGTCCTCCCACAGG + Intergenic
1146607929 17:34277754-34277776 GGTCAACAGATGCCTCACACAGG + Intergenic
1148191037 17:45678879-45678901 GGCACACAGAGACCTCCCAATGG + Intergenic
1149868411 17:60162968-60162990 GGGCCAAAGAGGCGGCCCACTGG - Intronic
1150003879 17:61457726-61457748 GAGGCAGAGAGGCCTCCCACAGG - Intronic
1152080132 17:78181999-78182021 TGTCCACCTTGGCCTCCCACAGG + Intronic
1152961443 18:82709-82731 GGTCCCCATAGGCCTCTGACTGG - Intergenic
1156459355 18:37312991-37313013 GTCCCACAGAGGCCTCCGAAAGG - Intronic
1156496078 18:37525884-37525906 TGCCCACAGAGTCCTCCTACAGG - Intronic
1156539775 18:37898273-37898295 GGCACACAGAGGCCTTCCAGGGG - Intergenic
1157721598 18:49929429-49929451 GGTACACAGAGGGCTCCCTGGGG + Intronic
1160149606 18:76389002-76389024 GGTTCCCAGAAGCCTCCCCCGGG - Intronic
1160769853 19:825731-825753 TGCCCTCAGAGGGCTCCCACAGG + Intronic
1160789495 19:917100-917122 GGTCCACAGCGGCCTCCACGCGG + Intergenic
1161953213 19:7478919-7478941 GGAGCACAGAGGCTGCCCACTGG - Intronic
1162113435 19:8413576-8413598 GGACCCCGGAGACCTCCCACCGG - Intronic
1163594704 19:18214275-18214297 GGTCAACAGAGGCATCCTAGAGG - Intronic
1163722116 19:18903291-18903313 GGCCCTCAGCGGCCTCCCAGCGG + Exonic
1165346470 19:35251612-35251634 GGTCCGCAGAGGACTCACAGAGG + Intronic
1166250808 19:41569744-41569766 GGTCCACAGTGACATCCCAGGGG + Intronic
1166416678 19:42600352-42600374 GGTCCACAGAGTTATCCGACAGG - Intronic
1167179509 19:47891856-47891878 GCTCCTCAGAGGCCTCACTCTGG - Intergenic
1168190138 19:54732195-54732217 GGTGCACAGATGCTTCCCAATGG - Intronic
1168419501 19:56191927-56191949 GGTTCACAGAGGAGGCCCACTGG + Exonic
1168457772 19:56527056-56527078 GGTCCACAGACACCTCATACAGG + Exonic
927909780 2:26889047-26889069 GGTTCACAAAGGCCTCCCAAAGG + Intronic
929969501 2:46561888-46561910 GGTCCAGGGTGGCCTCTCACTGG - Intronic
932646705 2:73510630-73510652 GGTCGACAGACACCTCACACAGG - Intronic
933765986 2:85710136-85710158 GGTCCAAAATGGCCTCCCACAGG - Intergenic
934859879 2:97755675-97755697 GGCCCCCAGAGCCCTCCCCCAGG + Intergenic
936977380 2:118233096-118233118 ATTCCCCAGAGGACTCCCACAGG - Intergenic
938163878 2:129009570-129009592 AGGCCACAGAGTCCTGCCACAGG - Intergenic
938732271 2:134155894-134155916 GGTCCAGGGAGGCCTCCCTGCGG - Intronic
939180455 2:138796663-138796685 GGTCTACAGACACCTCACACAGG + Intergenic
939942074 2:148362710-148362732 GGTCGACAGACACCTCACACAGG + Intronic
941579185 2:167273745-167273767 GGCCCACAGAAGCCTCCCACAGG - Intergenic
943222860 2:185132829-185132851 GGGCCTCAGCTGCCTCCCACGGG + Intergenic
943652069 2:190467996-190468018 GGTAAAGAGAGGCCACCCACAGG + Intronic
945302546 2:208227838-208227860 GGGCCTCAGCCGCCTCCCACTGG - Intergenic
946032946 2:216719405-216719427 GGTAAACAGAGGGCTACCACTGG - Intergenic
946245294 2:218383946-218383968 GGTCCTCAGAGACCTCACAGGGG - Intronic
946643359 2:221807624-221807646 GGTCCACTGGGCACTCCCACTGG + Intergenic
947525075 2:230872707-230872729 GATCCACACTGGCCCCCCACAGG - Intronic
948301224 2:236908926-236908948 GGTCCAGAGAGGGCTTCCAAGGG - Intergenic
948446362 2:238036588-238036610 TGCCCACAGTGGCCTCCCAAAGG - Intronic
948770728 2:240250207-240250229 GGTCCCCAGAGCTGTCCCACAGG - Intergenic
1170893094 20:20392322-20392344 TGCCCAGAGAGGCCTCACACAGG - Intronic
1170946206 20:20893263-20893285 GTCCCACAGAAACCTCCCACTGG + Intergenic
1172157700 20:32840351-32840373 GATCCACAGAGACCTCTGACAGG - Intronic
1174037907 20:47679320-47679342 GGACCACTGAGGCCTGTCACGGG - Intronic
1175308676 20:57995817-57995839 GGACCACACAGCCCACCCACAGG + Intergenic
1176293277 21:5057476-5057498 GGTCCGCAGAGGCAAACCACAGG - Intergenic
1176523015 21:7838805-7838827 GGTCTCCAGAGACCTCCCACAGG + Intergenic
1178657035 21:34468817-34468839 GGTCTCCAGAGACCTCCCACAGG + Intergenic
1179417226 21:41208493-41208515 GGACCACACAGGCCTCCCCCTGG - Intronic
1179417408 21:41209343-41209365 GGACCACACAGGCCTCCCCCTGG - Intronic
1179863983 21:44206174-44206196 GGTCCGCAGAGGCAAACCACAGG + Intergenic
1179951099 21:44709148-44709170 GGTCCTCAGATGGCTCCCACGGG + Intronic
1181588598 22:23868583-23868605 GCTCCAAAGAGGCCTCCCAGGGG - Exonic
1182117477 22:27765532-27765554 GGTCCTCAGAGGCCTTGCAGGGG - Intronic
1183348035 22:37318740-37318762 GGTCCAGAGAGGGTCCCCACTGG - Intergenic
1185047183 22:48534395-48534417 GGTCTGCAGAGGACTCCCACGGG + Intronic
1185245802 22:49772039-49772061 GCTGCTCAGAGGCCTCTCACGGG - Intergenic
951741761 3:25932209-25932231 GGTCAACAGACGCCTCATACAGG + Intergenic
955352712 3:58205878-58205900 GGGTCTCAGTGGCCTCCCACAGG - Intronic
956605755 3:71071390-71071412 AGTCCACAGAGGCCTCAAGCAGG + Intronic
957747605 3:84365681-84365703 GGTCAACAGACACCTCACACAGG - Intergenic
959914216 3:111797885-111797907 CTTCCACAGTGGCTTCCCACAGG - Intronic
961577766 3:127852097-127852119 GGAACACAGAGGCCTCACAGGGG + Intergenic
961907769 3:130280318-130280340 GGTTGACTGAGGCCTTCCACTGG + Intergenic
968231324 3:197006472-197006494 GGTAGACTGAGGCCTCCCAGGGG + Intronic
968461375 4:726885-726907 GGTCCCCGCAGGCCTCCCTCAGG + Intronic
968657679 4:1785672-1785694 GGGCCTCAGGGGCCTCCCAGGGG - Intergenic
968875109 4:3262569-3262591 GGTCCCCAGGGGCTTCCAACTGG - Intronic
968895264 4:3397228-3397250 GGCACACAGGGGCTTCCCACTGG - Intronic
969349715 4:6591403-6591425 GCTCCACAGTGCACTCCCACGGG - Intronic
969575484 4:8033924-8033946 TGGCCACAGAGCCCTCCCACAGG + Intronic
969691159 4:8704950-8704972 CCTCCACAGACTCCTCCCACAGG - Intergenic
972342255 4:38162554-38162576 GCTCCACAAAGGCCTCCAGCTGG + Intergenic
975227585 4:71892122-71892144 GGTCAACAGACACCTCACACAGG + Intergenic
975484105 4:74915607-74915629 GGTCAACAGACACCTCACACAGG - Intergenic
978054981 4:104252665-104252687 GGTCCACAGACACCTCATACAGG + Intergenic
980137373 4:128871790-128871812 GGTCCACAGATGTGTCCCAGAGG + Exonic
982060196 4:151597445-151597467 GGTCCACAGACACCTCATACAGG - Intronic
982297635 4:153846329-153846351 AGTCCACAGAGGCCTCCTGGTGG - Intergenic
982909149 4:161117663-161117685 GGTCGACAGACACCTCCAACAGG - Intergenic
983506096 4:168555458-168555480 GGTCCACAGAGGGCTCGCTGCGG - Intronic
983949373 4:173621985-173622007 GGTCGACAGACACCTCACACAGG - Intergenic
984765837 4:183399730-183399752 AGGCCACAGCGGCCTCCCAAAGG + Intergenic
985204549 4:187521201-187521223 GGTCGACAGACGCCTCATACAGG + Intergenic
985547888 5:519202-519224 GGTCCACAGGGCCCACTCACTGG + Intronic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
985653948 5:1120296-1120318 CGTCCACAGGGCCCCCCCACCGG + Intergenic
986923660 5:12718302-12718324 TGTCCACAGAGGCTTCCTACTGG + Intergenic
988021535 5:25627664-25627686 GGTCGACAGAGACCTCATACGGG + Intergenic
989137263 5:38167690-38167712 GGTCCCCAGAGGGCTCCTCCTGG + Intergenic
990308377 5:54515890-54515912 CAAGCACAGAGGCCTCCCACTGG + Intergenic
990559011 5:56965256-56965278 GGTACACATAGGCTTCCCAGGGG + Intronic
994005092 5:94828369-94828391 GGTCGACAGACGCCTCATACAGG - Intronic
994015112 5:94955990-94956012 GGTCGACAGACACCTCACACAGG + Intronic
995301982 5:110594996-110595018 GGTCAACAGACACCTCACACAGG + Intronic
997255543 5:132425188-132425210 GAGCCACAGAGTCCTGCCACAGG - Intronic
1001999362 5:176189022-176189044 GGTCCACAGGAGCCTCACTCTGG + Intergenic
1002677236 5:180927046-180927068 GGTCGACAGACGCCTCATACAGG + Intronic
1002862424 6:1091975-1091997 AGTCCACAGAACCCTCCCATGGG + Intergenic
1002996190 6:2287249-2287271 GGTCGACAGACACCTCCTACAGG + Intergenic
1005593078 6:27348677-27348699 TGTCCACATATGCCTCCCAGGGG + Intergenic
1007654870 6:43445921-43445943 GGGCCACAGGGGCCACCTACAGG + Exonic
1010116432 6:72317043-72317065 AGGCCACAGAGGCCTCTCAGAGG + Intronic
1013625583 6:111934384-111934406 GGTCAACAGACACCTCCTACAGG - Intergenic
1013672696 6:112422101-112422123 GGTCGACAGATGCCTCATACAGG + Intergenic
1013901830 6:115166070-115166092 GGTCGACAGACACCTCACACAGG - Intergenic
1015526458 6:134178546-134178568 GGTCCAGATAGTCCTCCTACTGG + Intronic
1015862986 6:137699912-137699934 GATCCAGAGAGGCCTCCTGCTGG + Intergenic
1017571489 6:155749311-155749333 GGTCGACAGACACCTCACACAGG + Intergenic
1017906522 6:158760537-158760559 CGTCCACAGATGCTTCCCCCTGG - Intronic
1019051975 6:169190403-169190425 GCTGCACACAGGGCTCCCACAGG - Intergenic
1019139394 6:169934061-169934083 GGTCCACTGAGGCCTCTTCCTGG - Intergenic
1019353119 7:564384-564406 GGAACACAGAGTCCTCCCAGAGG - Intronic
1019564177 7:1671410-1671432 GGTCCAAAGAGGCCCCACTCCGG - Intergenic
1020519509 7:9168785-9168807 GGTCAACAGATGCCTCATACAGG - Intergenic
1020999882 7:15315578-15315600 TGCCCACCTAGGCCTCCCACAGG + Intronic
1022883916 7:34622150-34622172 GCTCCTCAGAAGGCTCCCACAGG - Intergenic
1023968815 7:44977299-44977321 GGTCCACAGTGGTCTCCCCAGGG + Intronic
1024672283 7:51607098-51607120 ATTCCACAGAGGCCTCTCAGAGG + Intergenic
1029106120 7:98177718-98177740 GGTACACAGAGTTCTTCCACAGG - Intronic
1030035021 7:105401643-105401665 TGTCCACCTAGGCCTCCCAAAGG + Intergenic
1031031881 7:116743759-116743781 GGTCGACAGACACCTCACACAGG + Intronic
1037889719 8:22617479-22617501 GGTCCTCAGAAGCCTCGCCCCGG - Exonic
1039133925 8:34298295-34298317 GGTCGACAGAGACCTCATACAGG + Intergenic
1039566844 8:38558035-38558057 GCTCCACGGATGCCTCCCCCAGG + Intergenic
1042556224 8:70035412-70035434 GGTCCCCAGCAGCCTCCAACTGG - Intergenic
1044595179 8:93952688-93952710 GGTCGACAGATGCCTCATACAGG - Intergenic
1046916851 8:119687261-119687283 GTTCCACAGAGGTCTCCAAAAGG - Intergenic
1047402155 8:124556585-124556607 GGTACACAGGGGGCTCCCAAAGG - Intronic
1047727755 8:127698782-127698804 GGTTCACAGCAGCTTCCCACAGG + Intergenic
1049163534 8:141112481-141112503 GGTCCAAAGAGGGCTCCACCAGG + Intergenic
1049725559 8:144144095-144144117 GGTCCACAGAGGCCTCACCCTGG - Intergenic
1049831652 8:144704825-144704847 GGTCCACTGTGGGCTCCCTCGGG - Intergenic
1051180329 9:14405106-14405128 GATCCATAAAGTCCTCCCACTGG + Intergenic
1052096513 9:24390903-24390925 GTTCAACAGACGCCTCACACAGG - Intergenic
1052634082 9:31078350-31078372 GGTCATCAAAGGCCTCCCTCTGG - Intergenic
1053313286 9:37032851-37032873 GGTCCCCATGTGCCTCCCACAGG - Intronic
1053577143 9:39364405-39364427 GACCCACGGAGACCTCCCACAGG + Intergenic
1053608091 9:39680804-39680826 GGTCGACAGACACCTCACACAGG - Intergenic
1053841646 9:42192330-42192352 GACCCACGGAGACCTCCCACAGG + Intergenic
1053865934 9:42437164-42437186 GGTCGACAGACACCTCACACAGG - Intergenic
1054098714 9:60923095-60923117 GACCCACGGAGACCTCCCACAGG + Intergenic
1054120114 9:61198724-61198746 GACCCACGGAGACCTCCCACAGG + Intergenic
1054245441 9:62661605-62661627 GGTCGACAGACACCTCACACAGG + Intergenic
1054559569 9:66696136-66696158 GGTCGACAGACACCTCACACAGG + Intergenic
1054587642 9:66983838-66983860 GACCCACGGAGACCTCCCACAGG - Intergenic
1057160112 9:92883211-92883233 GGCCCCCAAGGGCCTCCCACCGG + Intergenic
1057519591 9:95750975-95750997 GGCCCACAGAGGCCTCCACAAGG + Intergenic
1059656579 9:116362988-116363010 GGGACACAGAAGACTCCCACAGG + Intronic
1061806564 9:133140506-133140528 GGTCCAGAAAGGGCTCCCATGGG - Intronic
1062217468 9:135397049-135397071 GGTCCACAGGGACCACCCCCAGG + Intergenic
1062499180 9:136845037-136845059 GGCCCACCGAGGCCGCGCACTGG + Exonic
1062682230 9:137788105-137788127 GGGCCACAGAGGCCTCTCAGAGG + Intronic
1062736711 9:138141409-138141431 GGTCCCCATAGGCCTCTGACTGG + Intergenic
1186487726 X:9946440-9946462 GGCCCCCAGAAGCCGCCCACAGG - Intronic
1189471112 X:41315068-41315090 GCTGCCCAGGGGCCTCCCACAGG + Intergenic
1190852176 X:54256201-54256223 GCTCCACAGAGGTCTATCACTGG - Intronic
1190943888 X:55072470-55072492 GGTCCACAGACACCTCATACAGG - Intergenic
1191582448 X:62779203-62779225 GGCCCACAGAGCCATGCCACAGG - Intergenic
1192586637 X:72324285-72324307 GGTAAACAGAGGCTTCTCACAGG + Intergenic
1192884193 X:75319970-75319992 GGTCTACAGACACCTCACACAGG - Intergenic
1194954338 X:100162013-100162035 GGTCAACAGACACCTCACACAGG - Intergenic
1195940832 X:110166574-110166596 GATCCCCACAGGCCTCCCAGGGG - Intronic
1196889787 X:120280790-120280812 AGTCCACAGAAGCCCCACACTGG + Intronic
1201011989 Y:9556730-9556752 GGACCACAGAGGGCTCACAGGGG - Intergenic