ID: 901642985

View in Genome Browser
Species Human (GRCh38)
Location 1:10702448-10702470
Sequence GATTTGCTCTGAGAAGCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 177}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901642979_901642985 9 Left 901642979 1:10702416-10702438 CCCAAAGCCTCCTGGGCTAGTGA 0: 1
1: 0
2: 1
3: 7
4: 101
Right 901642985 1:10702448-10702470 GATTTGCTCTGAGAAGCATCTGG 0: 1
1: 0
2: 1
3: 20
4: 177
901642984_901642985 -1 Left 901642984 1:10702426-10702448 CCTGGGCTAGTGAAGGAGGAAAG 0: 1
1: 1
2: 2
3: 26
4: 283
Right 901642985 1:10702448-10702470 GATTTGCTCTGAGAAGCATCTGG 0: 1
1: 0
2: 1
3: 20
4: 177
901642974_901642985 24 Left 901642974 1:10702401-10702423 CCACCATCATCGTTCCCCAAAGC 0: 1
1: 0
2: 1
3: 10
4: 149
Right 901642985 1:10702448-10702470 GATTTGCTCTGAGAAGCATCTGG 0: 1
1: 0
2: 1
3: 20
4: 177
901642975_901642985 21 Left 901642975 1:10702404-10702426 CCATCATCGTTCCCCAAAGCCTC 0: 1
1: 0
2: 0
3: 22
4: 260
Right 901642985 1:10702448-10702470 GATTTGCTCTGAGAAGCATCTGG 0: 1
1: 0
2: 1
3: 20
4: 177
901642980_901642985 8 Left 901642980 1:10702417-10702439 CCAAAGCCTCCTGGGCTAGTGAA 0: 1
1: 0
2: 1
3: 9
4: 159
Right 901642985 1:10702448-10702470 GATTTGCTCTGAGAAGCATCTGG 0: 1
1: 0
2: 1
3: 20
4: 177
901642978_901642985 10 Left 901642978 1:10702415-10702437 CCCCAAAGCCTCCTGGGCTAGTG 0: 1
1: 0
2: 0
3: 15
4: 187
Right 901642985 1:10702448-10702470 GATTTGCTCTGAGAAGCATCTGG 0: 1
1: 0
2: 1
3: 20
4: 177
901642983_901642985 2 Left 901642983 1:10702423-10702445 CCTCCTGGGCTAGTGAAGGAGGA 0: 1
1: 0
2: 1
3: 25
4: 182
Right 901642985 1:10702448-10702470 GATTTGCTCTGAGAAGCATCTGG 0: 1
1: 0
2: 1
3: 20
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901642985 Original CRISPR GATTTGCTCTGAGAAGCATC TGG Intronic
900482962 1:2908217-2908239 GATGTGCTCTGAGAAGCTGCAGG + Intergenic
900710821 1:4112551-4112573 GATGTGCGCAGAGAAGCATGAGG + Intergenic
901642985 1:10702448-10702470 GATTTGCTCTGAGAAGCATCTGG + Intronic
901866257 1:12109009-12109031 GGATAGCTCTGAGAAGCTTCAGG + Intronic
903260936 1:22131655-22131677 GATTTGCTGTGTGATGCACCTGG + Intronic
903398956 1:23024916-23024938 GAAGTGGTTTGAGAAGCATCAGG + Intronic
908755248 1:67463758-67463780 GATTTGCAATGAAAAGCAGCTGG - Intergenic
911845103 1:102742939-102742961 GCTTTGCTCTGAAATGCATTTGG - Intergenic
912823039 1:112882677-112882699 ATTTGGCTCTGAGAAGCCTCAGG - Intergenic
916283319 1:163076832-163076854 GACATGCTATGAGAAACATCAGG + Intergenic
916519530 1:165551420-165551442 GATTTGCTCTGAGATGCTAATGG + Intronic
917535881 1:175874221-175874243 GATCTGCTCTGATGTGCATCAGG - Intergenic
917648564 1:177052619-177052641 GATTGGCTCTGAGAAGATGCTGG - Intronic
918156939 1:181857204-181857226 TATTTGCTCTGAGGATCATATGG - Intergenic
918190095 1:182165321-182165343 ATTTTGCTCTGAGACTCATCTGG + Intergenic
918626498 1:186661312-186661334 GCTCAGATCTGAGAAGCATCAGG - Intergenic
921130952 1:212219382-212219404 GATTTGCTCTAAAATGCTTCAGG - Intergenic
921440993 1:215185826-215185848 AATCTGCTCTGAGGAGGATCAGG + Intronic
921851722 1:219939054-219939076 AATTTGCTCTCAGAAACAACAGG + Intronic
1065259035 10:23905611-23905633 TATTTGCTCTCAGAAGCCTGTGG - Intronic
1065821743 10:29532167-29532189 GATTTGCTTTGAGAATCAAAGGG + Exonic
1070443080 10:76465778-76465800 GATTTCCTCCGAGAACCATGAGG + Intronic
1070489563 10:76964041-76964063 GATTTGCTCTGCAAAGCCTCAGG - Intronic
1071713625 10:88073864-88073886 GATTTTCTGGGAGCAGCATCTGG - Intergenic
1071872335 10:89809031-89809053 CACTTCCTCTGAGCAGCATCTGG - Intergenic
1075707748 10:124511945-124511967 GCTTTGCTCTGACAAGCAAAAGG - Intronic
1076098459 10:127753675-127753697 GCCTTTCTCTGAGAAGCATAAGG + Intergenic
1078406525 11:11074781-11074803 GACTGGCTCTGGGAAGAATCAGG + Intergenic
1079322893 11:19466473-19466495 CATCTGCTCTGAGCAGCAGCTGG - Intronic
1081634851 11:44714266-44714288 CTTTTACTCTGAGAAGCAACAGG + Intergenic
1081982102 11:47273877-47273899 GTTTATCTCAGAGAAGCATCAGG - Exonic
1084911711 11:72394954-72394976 GATGTGCTCGTAGAAGCAACCGG - Intronic
1085358083 11:75857840-75857862 GACTTTCTCTGAGAAACATGTGG - Intronic
1085811927 11:79690951-79690973 GACATGCTCTGAGAAGGATGAGG + Intergenic
1086321021 11:85647883-85647905 GCTTTGGGCTGAGAAGCTTCCGG - Intergenic
1086931135 11:92694566-92694588 GAATCGCCCTGAGAATCATCAGG + Intronic
1087383714 11:97442272-97442294 TATTTGTTCTGAAAAGTATCAGG - Intergenic
1087993259 11:104771953-104771975 GGTTTGCTTTGAAAAGCAACAGG - Intergenic
1089633066 11:119795451-119795473 GATTTGCTCTGAGTAAGATGAGG + Intergenic
1089730175 11:120514272-120514294 TAATTGTTCTGAGAGGCATCTGG - Intronic
1093609856 12:21140946-21140968 GAGTTGCTCTGAGAAGTACTTGG + Intronic
1093989304 12:25572054-25572076 GATTTGCACTGAAACGTATCTGG - Intronic
1094268557 12:28586020-28586042 GATTTTATCTTAGCAGCATCAGG - Intergenic
1098809136 12:75061859-75061881 CTGTTGTTCTGAGAAGCATCAGG + Intronic
1100220537 12:92500246-92500268 GATTTGGTTTGAAAAGCATCTGG + Intergenic
1100505294 12:95214580-95214602 GCTTTGCTCTAAGAAGCTTTGGG - Intronic
1102755490 12:115336099-115336121 GATTTGCTTTGAGAATCATGAGG + Intergenic
1103469880 12:121171689-121171711 GCTATGCCCTGAGAAACATCGGG - Intronic
1107303068 13:38986424-38986446 TTTTTCCTCTGGGAAGCATCTGG - Intronic
1108166678 13:47700560-47700582 GATTTCTTCTTAGAAGGATCTGG - Intergenic
1109226519 13:59702768-59702790 GATTAGGTCAGAGAAGCAACAGG - Intronic
1110245806 13:73323067-73323089 AATTTCCTCTCAGCAGCATCAGG - Intergenic
1114344748 14:21782591-21782613 GTTTTGCTCTGAGATAGATCAGG + Intergenic
1117445337 14:55798836-55798858 TGTTTGCTTTGAGAATCATCTGG + Intergenic
1119530365 14:75355858-75355880 GATTTGCACTCAGGAACATCGGG - Intergenic
1120053826 14:79899174-79899196 GTTTTGATGAGAGAAGCATCAGG - Intergenic
1120782563 14:88498692-88498714 GGTGTGCTCTGAAAAGCTTCAGG + Intronic
1120876714 14:89382063-89382085 GATTTGGTCTGACAAGCAGTGGG - Intronic
1121306336 14:92910097-92910119 GCTCTGCTCAGAGAAGCACCTGG + Intergenic
1121744981 14:96281115-96281137 GATCTGCTATCAGAAGCATCAGG + Intergenic
1122953938 14:105061251-105061273 GATGTGCTCTGATAAGCAAAGGG - Intronic
1124121518 15:26892822-26892844 AACTTGCTCAGAGAAGCCTCCGG - Intronic
1125026663 15:35037210-35037232 GATTTGATCTGACAAGCAGGTGG - Intergenic
1125147981 15:36494848-36494870 GATCTGCTCAGAGAACAATCTGG - Intergenic
1128702696 15:69815745-69815767 GACTTGCTCTGAGAGGGACCTGG + Intergenic
1128893863 15:71355332-71355354 GTCTTGCTCTGAAAGGCATCAGG - Intronic
1131440155 15:92453859-92453881 GATTTGCTCTGTGAGGCTCCAGG + Intronic
1131753558 15:95536524-95536546 GGTTTGCTCTGGGACCCATCAGG - Intergenic
1133908531 16:10043375-10043397 GATTTGCTCAGAAAGGCAGCCGG + Intronic
1136636797 16:31529383-31529405 GAATTGATCTGAGAAGCTTGGGG - Intergenic
1138237603 16:55398287-55398309 GATGTGCTCTGGGAAGTAACGGG + Intronic
1140981179 16:80111246-80111268 GTTTTGCTCTGAGCTGAATCAGG + Intergenic
1142588719 17:991088-991110 GATTTGATCTGAAAAGTATTGGG - Intergenic
1144052508 17:11509069-11509091 GATGGGCTCTCAGAATCATCAGG + Intronic
1144278852 17:13704068-13704090 CACTTCCTCTGAGAAGCCTCTGG - Intergenic
1144668370 17:17117208-17117230 GATGTGCACTGAGAAGCAGCAGG + Intronic
1144687005 17:17232674-17232696 GCCTTTCTCTGAGAGGCATCAGG + Intronic
1144947784 17:18978558-18978580 GATCTCCTCTGAGAAGCAGGAGG - Exonic
1147635787 17:41963016-41963038 GAGCTGCTCTGAGAAGCCACAGG + Intronic
1148381811 17:47205257-47205279 AACTTTCTCTGGGAAGCATCTGG - Intronic
1149001213 17:51759617-51759639 GTTTTGCTTTGAGCATCATCTGG + Intronic
1149140528 17:53428019-53428041 CATTTGCTGTTAGAAGCAGCAGG - Intergenic
1149467465 17:56891369-56891391 GATTTTCTCTAAGAGGAATCGGG + Exonic
1149954902 17:61037775-61037797 CATTTTCTCTGAGCAGCCTCAGG + Intronic
1150063322 17:62087698-62087720 GCCTAGCTCTGAGAAGGATCTGG + Intergenic
1150188341 17:63210743-63210765 GATTTGCTCTTAAAATAATCAGG + Intronic
1150383209 17:64737188-64737210 GATTTGCTATGAAAAGCAACAGG - Intergenic
1150773029 17:68057581-68057603 GGTTTGCTATGAAAAGCAACAGG + Intergenic
1153341955 18:3984598-3984620 GCTTGGCTGTGAGAAGCATTGGG - Intronic
1156197509 18:34791439-34791461 GATTTGATCTGTGAATCTTCTGG - Intronic
1163136658 19:15316314-15316336 GACTTGCTCTGAGTAGCAAAAGG + Intronic
1163609750 19:18294720-18294742 GATGTGCCCAGAGAAGCATCCGG + Intergenic
1163839347 19:19596586-19596608 GATTTACTCTGAAAGGAATCAGG + Intronic
926636340 2:15183890-15183912 CATTTGATCTCAGAATCATCTGG - Intronic
928598999 2:32885538-32885560 GATCTGCAATGAGAAGCATCGGG - Intergenic
931643856 2:64404336-64404358 GATTGGCTCTGTGTAGCATCCGG - Intergenic
934669629 2:96202538-96202560 GATTTGCTCAGAGAACAATCAGG + Intronic
936562659 2:113555021-113555043 CACTTCCTCTGTGAAGCATCAGG + Intergenic
936877864 2:117213999-117214021 GAATTCGTCTGAGAAGCATAAGG - Intergenic
946173627 2:217909666-217909688 GTTGTTCTCGGAGAAGCATCTGG - Intronic
948995829 2:241577739-241577761 TATTTGATCCAAGAAGCATCTGG - Intergenic
1168887095 20:1267188-1267210 CTTTCCCTCTGAGAAGCATCAGG + Intronic
1169204268 20:3731473-3731495 GAGGTGGACTGAGAAGCATCTGG + Intergenic
1169724135 20:8711041-8711063 TATTTACTCTTAGAAGCACCTGG - Intronic
1170248081 20:14246258-14246280 GATTTGCTCTGAGGACAATCAGG + Intronic
1171055609 20:21903495-21903517 GCTCTGCACTGAGAAGCACCAGG - Intergenic
1171128379 20:22624752-22624774 GACTTAATCTGAAAAGCATCTGG - Intergenic
1172533963 20:35656390-35656412 AATTTGCTCTTAGAAGCCTTTGG - Intronic
1173444594 20:43106273-43106295 CATTTGCACTGAAAAGCATGGGG - Intronic
1176518385 21:7804789-7804811 CATTTACCCAGAGAAGCATCTGG + Intergenic
1176965196 21:15205092-15205114 GATGTTCTCTGGGAAGCATGAGG - Intergenic
1177766191 21:25460355-25460377 GATTTGCTAGGAGAAGAATATGG - Intergenic
1178120500 21:29465224-29465246 GACTTGCTGTGAGAAGGCTCAGG + Intronic
1178652413 21:34434802-34434824 CATTTACCCAGAGAAGCATCTGG + Intergenic
1182729264 22:32474451-32474473 CATCTGCTCTGAGAAGCCTTAGG - Intergenic
1184873128 22:47253694-47253716 GATTTCCTCTTTGAAGTATCTGG - Intergenic
1184944478 22:47793482-47793504 GACTGACTCTGAGATGCATCTGG + Intergenic
1185333754 22:50262562-50262584 GCTTTGCCCTCAGGAGCATCTGG - Intergenic
949330987 3:2921938-2921960 GATTATCTATGAGAAGCATCTGG - Intronic
950653944 3:14425111-14425133 GATTTGCTCTCAGGAGAAACAGG - Intronic
952541600 3:34373102-34373124 GAGTATCTCTGAGAGGCATCAGG + Intergenic
953212479 3:40888325-40888347 GTTTGGCTCTGAGGAGCAGCTGG - Intergenic
953868656 3:46607074-46607096 GACTGGCTCAGTGAAGCATCTGG + Intronic
955467867 3:59255034-59255056 GATTGGCTGTGAGAAGAAGCAGG - Intergenic
955878146 3:63515306-63515328 GATTTAATCTGAGAAGCATGAGG - Intronic
961918361 3:130400282-130400304 TAGTTGCTCTGAGAAACATCAGG - Intronic
963918141 3:150879542-150879564 CATTTGGTCTGGGAAGCATCTGG - Intronic
964572237 3:158120426-158120448 GCTTTGCTTTCAGAAGCATCAGG - Intronic
965840920 3:172904813-172904835 GCTTTGCTCTGTAAACCATCTGG + Intronic
966471308 3:180292262-180292284 GATTTGCACCAAGAGGCATCTGG + Intergenic
967234429 3:187370522-187370544 GATTTTCCCTCAGAGGCATCTGG + Intronic
970961600 4:21877912-21877934 GAATTGTTCTGAGAAGGCTCTGG - Intronic
972915509 4:43873197-43873219 GATTTGTTCTGAGAAGTCTGAGG + Intergenic
974364092 4:60923309-60923331 GATGTGTACTGAGAAGCAGCAGG - Intergenic
977378804 4:96243263-96243285 AATTTGCTATGAGAAAAATCTGG + Intergenic
979333818 4:119445312-119445334 GCTTTGCTCTTATAAGGATCCGG - Intergenic
981402718 4:144332714-144332736 GATTTTCTATGAGTAGCACCTGG - Intergenic
981613763 4:146624262-146624284 CATTTGGTCTAAGTAGCATCAGG + Intergenic
984569912 4:181379893-181379915 CATTTTATCTGAGAAGCATAAGG + Intergenic
985855330 5:2419874-2419896 GATTTCCTCTGACGAGCAACGGG - Intergenic
987429775 5:17818516-17818538 GATTTACTTTGAAGAGCATCTGG - Intergenic
989458788 5:41672315-41672337 GATTTTTTTTCAGAAGCATCTGG + Intergenic
991149142 5:63345833-63345855 GATTAGCTCTAAGAAGCATCTGG + Intergenic
991903601 5:71485380-71485402 GAATTTCTCTGAGAACCATGTGG + Intronic
994138911 5:96320549-96320571 GATTTCCTCTGAGCAGCACTGGG + Intergenic
997180919 5:131828161-131828183 GATTTGTTTTGAGACACATCTGG + Intronic
999033179 5:148317378-148317400 GTTTTCCTCTGGTAAGCATCTGG + Intergenic
1002980576 6:2132396-2132418 CTATTGCTCTGAGAAGTATCTGG + Intronic
1005709360 6:28488973-28488995 GATTTTCTCTGGAAAACATCAGG + Intergenic
1006817584 6:36863163-36863185 CATTTTCTCTGAGAAGCTGCTGG + Intronic
1006844784 6:37054710-37054732 GAGGTGTTCTGAGGAGCATCAGG - Intergenic
1007094351 6:39204183-39204205 GATTTGCTCTGATATCTATCTGG + Intronic
1010769885 6:79816289-79816311 GTTGTTCTCTGAGAAGCCTCAGG + Intergenic
1012264010 6:97119345-97119367 GATTTGCTCTGAGAAACCAAAGG - Intronic
1014697980 6:124647766-124647788 GATTTTCTCTCAGAATCATGTGG - Intronic
1014741599 6:125153894-125153916 CATCTGCTCTGGGAAGCACCAGG + Exonic
1016681784 6:146838856-146838878 AATTTGCTCTGTGAAACATGTGG + Intergenic
1018267850 6:162044350-162044372 GAACTGCTCTGGGAAGCACCTGG - Intronic
1019649305 7:2148131-2148153 AATTGGCTTTTAGAAGCATCTGG - Intronic
1020485167 7:8712389-8712411 GATTTACTTTGCTAAGCATCAGG - Intronic
1020673378 7:11148257-11148279 GATTTGCAGTGAGAAGCCACTGG - Intronic
1024364679 7:48507547-48507569 GATATCCTCTGAGCAGCATCCGG - Intronic
1026473179 7:70711600-70711622 GATTTGCTCTGACATGAACCAGG - Intronic
1031421644 7:121559272-121559294 GACTTTCTATGTGAAGCATCTGG - Intergenic
1031458574 7:122015046-122015068 AATCTGCTCTAAGAAACATCTGG - Intronic
1031771307 7:125847942-125847964 CATTTGCTCTGTGCAGCCTCGGG + Intergenic
1034971990 7:155424934-155424956 CATTTGCTCTTAGATTCATCAGG - Intergenic
1035052280 7:156005753-156005775 CTCATGCTCTGAGAAGCATCAGG + Intergenic
1037672322 8:21025804-21025826 GATCTTCTATGAGAAGGATCTGG + Intergenic
1037895978 8:22655967-22655989 GATTTGCTTTGCTAAGTATCAGG - Intronic
1037935357 8:22911888-22911910 TATTTGATCTGAGAAACATCTGG + Intronic
1039298984 8:36188960-36188982 GGTATTCTCTGAGAAGCCTCTGG + Intergenic
1043462822 8:80478043-80478065 CATTTGCTTTGAGAACTATCTGG - Intergenic
1044195077 8:89366409-89366431 GATTTGCTCTGAGAAATAACTGG + Intergenic
1047018908 8:120753670-120753692 GATAAGATCAGAGAAGCATCAGG + Intronic
1048500408 8:134970098-134970120 CTTTGGCTCTGAGAAGCAACAGG - Intergenic
1048869260 8:138783730-138783752 GAAATGCTCTGGGAAGCACCTGG - Intronic
1048951704 8:139501933-139501955 GATGTGGTCTGAGAAGGCTCTGG + Intergenic
1049306053 8:141904883-141904905 GAGCTGCTCTGGGAAGCAGCTGG + Intergenic
1049890074 9:60676-60698 CACTTCCTCTGTGAAGCATCAGG - Intergenic
1052364055 9:27591267-27591289 GATTTCCTGTAAGAATCATCTGG - Intergenic
1052751004 9:32490702-32490724 AATATGCTTTGAGAAGCATAAGG + Intronic
1053116623 9:35510004-35510026 GATTTGCTCTTTTCAGCATCAGG - Intronic
1053731549 9:41061952-41061974 CACTTCCTCTGTGAAGCATCAGG - Intergenic
1055726093 9:79230573-79230595 AATTTCCTCTGAGAAGAATTTGG - Intergenic
1055841266 9:80507185-80507207 GAATTGCTCTCAGAATCACCAGG + Intergenic
1056705621 9:88950298-88950320 CATTTGCTCACAGAAGCATTTGG + Intergenic
1057124916 9:92609460-92609482 CGTTTTCCCTGAGAAGCATCTGG - Intronic
1058616679 9:106836815-106836837 GATTTTTTATGAGAAGAATCTGG - Intergenic
1058954647 9:109934359-109934381 GATGTGCTCTGAGTAGCTCCAGG - Intronic
1059616146 9:115953190-115953212 GTTTTGTTCTGGGAAGCATGAGG - Intergenic
1059616396 9:115956131-115956153 GAGTAGCTCTGAGAAACACCAGG + Intergenic
1062565578 9:137162597-137162619 GATGCGCGCTGAGAAGCTTCTGG - Exonic
1191796786 X:65029813-65029835 GATTTGCTGTGTGAAGGATGAGG + Intronic
1193967148 X:88002401-88002423 GAATTGCTCTGTAAAGCAACTGG - Intergenic
1194038883 X:88915367-88915389 AATTTGCTCTGTGCAGCCTCAGG - Intergenic
1198852991 X:140985799-140985821 TAATTGCTCTGTAAAGCATCAGG + Intergenic
1199893744 X:152113340-152113362 GATTTGCATGGAAAAGCATCTGG - Intergenic
1202046879 Y:20744418-20744440 GATTTCCGCTGAGAGGCATAAGG - Intergenic