ID: 901642985

View in Genome Browser
Species Human (GRCh38)
Location 1:10702448-10702470
Sequence GATTTGCTCTGAGAAGCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 177}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901642984_901642985 -1 Left 901642984 1:10702426-10702448 CCTGGGCTAGTGAAGGAGGAAAG 0: 1
1: 1
2: 2
3: 26
4: 283
Right 901642985 1:10702448-10702470 GATTTGCTCTGAGAAGCATCTGG 0: 1
1: 0
2: 1
3: 20
4: 177
901642978_901642985 10 Left 901642978 1:10702415-10702437 CCCCAAAGCCTCCTGGGCTAGTG 0: 1
1: 0
2: 0
3: 15
4: 187
Right 901642985 1:10702448-10702470 GATTTGCTCTGAGAAGCATCTGG 0: 1
1: 0
2: 1
3: 20
4: 177
901642980_901642985 8 Left 901642980 1:10702417-10702439 CCAAAGCCTCCTGGGCTAGTGAA 0: 1
1: 0
2: 1
3: 9
4: 159
Right 901642985 1:10702448-10702470 GATTTGCTCTGAGAAGCATCTGG 0: 1
1: 0
2: 1
3: 20
4: 177
901642979_901642985 9 Left 901642979 1:10702416-10702438 CCCAAAGCCTCCTGGGCTAGTGA 0: 1
1: 0
2: 1
3: 7
4: 101
Right 901642985 1:10702448-10702470 GATTTGCTCTGAGAAGCATCTGG 0: 1
1: 0
2: 1
3: 20
4: 177
901642974_901642985 24 Left 901642974 1:10702401-10702423 CCACCATCATCGTTCCCCAAAGC 0: 1
1: 0
2: 1
3: 10
4: 149
Right 901642985 1:10702448-10702470 GATTTGCTCTGAGAAGCATCTGG 0: 1
1: 0
2: 1
3: 20
4: 177
901642975_901642985 21 Left 901642975 1:10702404-10702426 CCATCATCGTTCCCCAAAGCCTC 0: 1
1: 0
2: 0
3: 22
4: 260
Right 901642985 1:10702448-10702470 GATTTGCTCTGAGAAGCATCTGG 0: 1
1: 0
2: 1
3: 20
4: 177
901642983_901642985 2 Left 901642983 1:10702423-10702445 CCTCCTGGGCTAGTGAAGGAGGA 0: 1
1: 0
2: 1
3: 25
4: 182
Right 901642985 1:10702448-10702470 GATTTGCTCTGAGAAGCATCTGG 0: 1
1: 0
2: 1
3: 20
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901642985 Original CRISPR GATTTGCTCTGAGAAGCATC TGG Intronic