ID: 901646006

View in Genome Browser
Species Human (GRCh38)
Location 1:10717068-10717090
Sequence GCTGCTGGAGGGACAGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 898
Summary {0: 1, 1: 2, 2: 13, 3: 84, 4: 798}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901645994_901646006 13 Left 901645994 1:10717032-10717054 CCTCAGGGCTCCCCTAGAGAGAC 0: 1
1: 0
2: 2
3: 22
4: 133
Right 901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG 0: 1
1: 2
2: 13
3: 84
4: 798
901645998_901646006 2 Left 901645998 1:10717043-10717065 CCCTAGAGAGACTCAGATGGGCT 0: 1
1: 0
2: 0
3: 11
4: 137
Right 901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG 0: 1
1: 2
2: 13
3: 84
4: 798
901645999_901646006 1 Left 901645999 1:10717044-10717066 CCTAGAGAGACTCAGATGGGCTG 0: 1
1: 0
2: 1
3: 19
4: 212
Right 901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG 0: 1
1: 2
2: 13
3: 84
4: 798
901645991_901646006 30 Left 901645991 1:10717015-10717037 CCTAGCAGAGGGCTGGGCCTCAG 0: 1
1: 2
2: 7
3: 48
4: 436
Right 901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG 0: 1
1: 2
2: 13
3: 84
4: 798
901645997_901646006 3 Left 901645997 1:10717042-10717064 CCCCTAGAGAGACTCAGATGGGC 0: 1
1: 0
2: 0
3: 9
4: 110
Right 901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG 0: 1
1: 2
2: 13
3: 84
4: 798

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901646006 Original CRISPR GCTGCTGGAGGGACAGGAGC AGG Intronic
900146025 1:1158951-1158973 GCTGCTGGAGGACCCCGAGCTGG - Intergenic
900300317 1:1973716-1973738 GCTGCCGGAGGGAAAGGGGAGGG + Intronic
900306895 1:2014536-2014558 GCTGCTGGGGAGACAAGATCTGG - Intergenic
900345944 1:2210339-2210361 GGTGCTGGCGGGACAGGGGGTGG + Intronic
900545686 1:3227830-3227852 GCTCCTGTGGGGACAGGTGCTGG + Intronic
900669430 1:3841571-3841593 GCTGCTGAATCAACAGGAGCTGG - Intronic
900713109 1:4127532-4127554 GCTCCTGGAGGGAGAAGTGCTGG + Intergenic
900782913 1:4629494-4629516 GCTCCTGCAGGGACAGGACATGG - Intergenic
900807425 1:4776627-4776649 GCTGCTGGAAGGGGAGGACCAGG - Intronic
901156223 1:7141307-7141329 GGTGTTTGGGGGACAGGAGCAGG - Intronic
901468420 1:9438742-9438764 GCTTCTACAGGGAGAGGAGCCGG - Intergenic
901475297 1:9485296-9485318 GCTACTGGAGGGCCAGGCGTGGG + Intergenic
901475602 1:9487172-9487194 GATGCTGGAGTGACCGGAGGAGG - Intergenic
901510393 1:9715522-9715544 GCAGCTGGAGGGACAGTCACCGG - Exonic
901516814 1:9753235-9753257 GCTGCTGATGTGACAGGAGGTGG + Intronic
901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG + Intronic
901720597 1:11193977-11193999 GCTGCAGGTGGGACAGGAAGAGG + Intronic
901827204 1:11869955-11869977 CCTGCTGGAGGGGCCGGAGTGGG + Intergenic
901987766 1:13089755-13089777 GCTTCTGGAGTGACCAGAGCAGG - Intergenic
901994046 1:13137012-13137034 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
902159118 1:14515393-14515415 GCAGCAGGAGGGATGGGAGCAGG + Intergenic
902552768 1:17229175-17229197 GCTGGTGGCAGGACAGCAGCAGG + Intronic
902619555 1:17642935-17642957 GGTGCTGGAGGGATGGGAGACGG + Intronic
902814279 1:18907386-18907408 GCTGCTGGCAGTGCAGGAGCTGG - Exonic
902814285 1:18907413-18907435 GCTGCTGGCAGGAGAGAAGCAGG - Exonic
902950934 1:19882470-19882492 GCGGCAGGAGGGAAAGGCGCAGG - Intergenic
903029124 1:20450263-20450285 GGTGCAGGAGGGGCAGGAGGGGG + Intergenic
903328869 1:22586726-22586748 TCTGCTGGTGGGGCAGGGGCGGG + Intronic
903455505 1:23484260-23484282 GCGGCTGGAGGGTCGGGGGCGGG - Intronic
903469477 1:23575800-23575822 GGTGGGGGAGGGTCAGGAGCAGG + Intergenic
903555049 1:24187200-24187222 CCTGCAGCAGGCACAGGAGCAGG + Exonic
903867375 1:26409622-26409644 GCTGGTGGAGGAACAGGACTGGG - Intergenic
904012269 1:27396596-27396618 GCTGAGTGAGGGACAGCAGCTGG + Intergenic
904055641 1:27668372-27668394 AGTCCTGGAGGAACAGGAGCAGG + Exonic
904966914 1:34381297-34381319 GGTGCTGGAGGGGAAGGAGGAGG - Intergenic
905033125 1:34900765-34900787 GATTGTGGAGGGCCAGGAGCAGG + Intronic
905183471 1:36180090-36180112 GCTGCTGGGAGGAATGGAGCTGG - Intronic
905732732 1:40307669-40307691 GCTGCTGATGGGACTGGGGCAGG - Intronic
905804968 1:40869615-40869637 GCTGCTGGAGAGGCTGGGGCAGG + Intergenic
905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG + Intergenic
905969985 1:42134478-42134500 GCTGCTCCAGGGAAAGGAGGGGG - Intergenic
906001998 1:42434577-42434599 GCTGCTGAACTGACAGGAGGTGG - Intronic
906344647 1:45007559-45007581 GCCGCTGGCGGGACAGCAGTAGG + Exonic
906778835 1:48554145-48554167 TTTGCTGGAGGGACAGGACATGG + Intronic
907012712 1:50978163-50978185 GCTGCCTGAGGGCCAGGACCGGG - Intergenic
907464427 1:54625304-54625326 GCTGCTGGCTGGAATGGAGCAGG + Intronic
907675271 1:56512092-56512114 ACTGCAGGAGGGGCCGGAGCAGG + Exonic
911647498 1:100352341-100352363 GCTGCTGCGGAGAAAGGAGCGGG + Intronic
912143265 1:106757996-106758018 GCTGCAGGAAGAAAAGGAGCTGG - Intergenic
912698109 1:111856336-111856358 GCTGCTATAGGGAGAAGAGCAGG - Intronic
912800753 1:112718683-112718705 GGTGCTGGGGGGAAAGGAGCTGG - Intergenic
913570066 1:120110854-120110876 GCTGCTGGGGAGACATCAGCCGG + Intergenic
914290875 1:146271820-146271842 GCTGCTGGGGAGACATCAGCCGG + Intergenic
914551919 1:148722603-148722625 GCTGCTGGGGAGACATCAGCCGG + Intergenic
914950749 1:152111299-152111321 GCTGCTGAAGAGCGAGGAGCAGG - Exonic
915128304 1:153680440-153680462 ACTGCGGGAGAGACAGGAGTAGG - Intronic
915472811 1:156135972-156135994 GCTGCTGGCGGAAAAGGAGCGGG + Exonic
915602195 1:156929456-156929478 GGTGCTGGACGGACAGGGGAGGG + Intronic
915936740 1:160094067-160094089 GGTGCATGAGGGGCAGGAGCTGG - Exonic
915973112 1:160367650-160367672 GCTGCTGCCGGGACTGGAACTGG + Intronic
917050846 1:170920754-170920776 CCTTCTTGAGGGACAGAAGCTGG - Intergenic
917440759 1:175066985-175067007 GCTGCTGGAGGGAAAGGAGAAGG - Intergenic
917913914 1:179681187-179681209 GCTGCTTGAGAGACTGAAGCAGG - Intronic
918384862 1:183995465-183995487 GTGGCTGGAGGGAGAGGAACAGG + Intronic
919758236 1:201079364-201079386 GCTGCTGGGAGGTCAGGAGCAGG - Intronic
920022671 1:202967321-202967343 GCGGCTGGGGGGGCAGGAGGCGG + Intergenic
920032917 1:203048265-203048287 GCAGCTGGAGGGACAGCTGGAGG + Intronic
920180969 1:204131509-204131531 CCTGCTGGGGGGACAGGAGAGGG - Exonic
920361449 1:205419574-205419596 GCTGCTGGAGGGGCTGAGGCCGG - Intronic
920711432 1:208298951-208298973 GCTGGGGGAGGGAAAGGGGCTGG + Intergenic
922314883 1:224434158-224434180 GCGGCGGGAGGGGCAGCAGCCGG + Exonic
922346275 1:224699364-224699386 GCTGCCGAAGGGCCAGGAGAAGG - Intronic
922414002 1:225403821-225403843 GCTGGTGGAGGTGGAGGAGCTGG - Intronic
922570715 1:226633322-226633344 GCTGTCAGAGGTACAGGAGCTGG - Exonic
922900594 1:229133554-229133576 GCCGCTGGAATGAGAGGAGCAGG - Intergenic
923704436 1:236332592-236332614 GCTGCTGATCGGACAGGAGGCGG - Intergenic
924842732 1:247730760-247730782 GATGTTGGAGGGCCAGGAGAAGG + Intergenic
1062989207 10:1799969-1799991 GGTGCTGGAGGGCCAGGGACAGG + Intergenic
1063058835 10:2529661-2529683 GCTGGGGGACGGACAGGTGCAGG + Intergenic
1063597953 10:7454229-7454251 GCTGGAGGAGGGAGAGGATCAGG + Intergenic
1063983216 10:11473276-11473298 GGTGCTGGTGAGGCAGGAGCCGG + Intronic
1064035108 10:11908430-11908452 GCCCCAGCAGGGACAGGAGCTGG - Intergenic
1064582708 10:16810447-16810469 GCTGCTGGGGGAACAGCAGCAGG - Intronic
1065214446 10:23437307-23437329 GCGGCTGGAGTGACCTGAGCTGG + Intergenic
1065789171 10:29243926-29243948 CCTGCTGCAGGGACAAGGGCAGG + Intergenic
1065917336 10:30364835-30364857 ACTGCTGGAGCTGCAGGAGCTGG - Intronic
1066397539 10:35040890-35040912 GCTGCTGATGTGACAGGAGGCGG + Intronic
1066617224 10:37307710-37307732 GGTGCTGCAGGGACAGATGCTGG + Intronic
1067110461 10:43396719-43396741 GCTGCTGGAGTGCCGTGAGCAGG - Exonic
1067577646 10:47418412-47418434 GCAGCAGCAGGGTCAGGAGCAGG - Intergenic
1067842442 10:49691749-49691771 CCTGCAGGAGGGCCAGGGGCAGG + Intronic
1068937767 10:62652738-62652760 TCTGCTGAAGGGACAGGCCCAGG + Intronic
1068982164 10:63073079-63073101 GCTGCTGTGGGGACACGGGCTGG + Intergenic
1069540043 10:69287252-69287274 GCTGCAGGAAGGAGAGGTGCAGG + Intronic
1069679979 10:70277537-70277559 TGTGCTGGAGGGACACCAGCTGG + Intronic
1069778338 10:70939624-70939646 GCTGCTGGAGGCACAGGGGCAGG + Intergenic
1069997703 10:72353228-72353250 GCTGCTGCGGGCTCAGGAGCAGG - Intronic
1070352953 10:75611051-75611073 GCTGCTGCAGAGGCTGGAGCTGG + Intronic
1070670748 10:78375657-78375679 GGCGCTGGAGGGACGGGAGCAGG + Intergenic
1070810247 10:79293868-79293890 GCTGCTTGAGGGACTTGAGGAGG + Intronic
1070812515 10:79305542-79305564 TCTGCTGGAGGGCCTGGAGGTGG + Exonic
1071060265 10:81561889-81561911 GTTGATAGAGGGAGAGGAGCAGG - Intergenic
1071380085 10:85050386-85050408 GATGGCAGAGGGACAGGAGCAGG + Intergenic
1071420512 10:85492653-85492675 GCTGCTGGAAGGGAAGGAGACGG + Intergenic
1072812964 10:98477842-98477864 GCTGCTGGTCTGACAGGAGGTGG - Intronic
1072921678 10:99582181-99582203 GGTGCTGGAGGGATATGAGGAGG + Intergenic
1072927325 10:99627550-99627572 GCTACTTGGGGGACAGAAGCAGG - Intergenic
1073326293 10:102645543-102645565 GCAGCTGGAGAGGCAGGACCGGG - Intronic
1073609794 10:104931764-104931786 GCTTATGCAGGGACAGTAGCAGG + Intronic
1073697990 10:105892488-105892510 GCTGCTTGAGAGACTGGGGCAGG - Intergenic
1074139743 10:110661410-110661432 GATGGTGGAGGGAGAGCAGCAGG + Intronic
1074532257 10:114305686-114305708 GCTGCAGGAGGGAGCGGGGCTGG + Intronic
1075442502 10:122491275-122491297 ACTGCTGGAGGGATAGAGGCCGG + Intronic
1075494658 10:122909612-122909634 GCTGCCTGAGGGACAGAAGGAGG + Intergenic
1075605871 10:123807469-123807491 GTAGCTGCAGGGAGAGGAGCAGG - Intronic
1076110465 10:127855760-127855782 GCTCCTGCAGGGGCTGGAGCTGG + Intergenic
1076176789 10:128374431-128374453 GCTTCTGGAAGGACATAAGCAGG + Intergenic
1076215966 10:128693603-128693625 GCTGCAGCAGGGACAGGGACCGG - Intergenic
1076353809 10:129838162-129838184 GCTGCAGGAGGGGCAGGACTGGG - Intronic
1076451440 10:130559741-130559763 TGTCCTGGAGGGGCAGGAGCAGG + Intergenic
1076682237 10:132179089-132179111 GCGGCAGCAGGGACAGGAGATGG - Intronic
1076707394 10:132309110-132309132 GCGGTGGGAGGGACGGGAGCGGG - Intronic
1076718883 10:132384018-132384040 GCTGCTGGAGGCCCTGGGGCAGG - Intergenic
1076885583 10:133261027-133261049 GCTACTGGAGGACAAGGAGCAGG - Intergenic
1077081330 11:725935-725957 GCGGCTGGAGAGACTGGGGCAGG + Intronic
1077225290 11:1436827-1436849 GCTGCGGGTGGGGCAGGACCCGG + Intronic
1077433746 11:2528411-2528433 GCTGCTGCTGGGACACCAGCAGG - Intronic
1078050301 11:7960099-7960121 GCTGCTGGAGGTAAAGGAGCAGG - Exonic
1078059102 11:8032005-8032027 GGGGCTGGAGGGGCAGCAGCTGG + Intronic
1078144308 11:8712640-8712662 GCTGCTGGAGTGGCAGGAGCGGG - Exonic
1078265000 11:9748646-9748668 GGTGCTGAAGGGACACGAGGAGG - Intronic
1078327046 11:10389331-10389353 GGTGCTGGAGAGACAGCTGCAGG - Intronic
1078553096 11:12293832-12293854 TCTGGGGGAAGGACAGGAGCTGG + Exonic
1079090338 11:17476353-17476375 GCTTCTGCAGGGCCAAGAGCTGG - Intronic
1080898936 11:36469284-36469306 ACTGGTGGAGGGAGAGGAGTTGG + Intergenic
1081567343 11:44268213-44268235 CCTGGAGGAGGGACAGGAGCTGG + Intronic
1083294491 11:61707777-61707799 GCAGGTGGAAAGACAGGAGCTGG + Intronic
1083314377 11:61805224-61805246 GCAGGTGAAGGGGCAGGAGCAGG + Intronic
1083595815 11:63917811-63917833 GCTGCAGGGGAGAGAGGAGCTGG + Intergenic
1083636873 11:64125555-64125577 GCTGCTGGCGGGGCAGGAGCAGG - Intronic
1083721612 11:64606450-64606472 GCTGCTGGAGGAGCAGGGGTGGG - Exonic
1083751010 11:64760524-64760546 GCTCCTTGAGGGACAGCAACAGG - Intergenic
1083800139 11:65041748-65041770 GCTGCTGCAGGCCCAGGTGCAGG + Exonic
1083911595 11:65713126-65713148 GCTCCTGGATGGGCAGGAGGCGG + Intronic
1084088569 11:66865879-66865901 GGAGCTGGAGGGTCAGGGGCTGG + Intronic
1084156265 11:67314461-67314483 GCTGCAGGAGGGGCAGGGCCTGG - Intergenic
1084742109 11:71146590-71146612 AGGGCTGGAGGGACAGGAGGAGG + Intronic
1084803987 11:71566141-71566163 GCAGCTGGACTGACAGCAGCAGG - Exonic
1084860510 11:72014937-72014959 GCTGCAGGAGGCAAAGGAGAAGG - Exonic
1084860632 11:72015669-72015691 GCAGCTGGAGGCACTGGAGAAGG - Exonic
1085040493 11:73323777-73323799 GCTGGTGGAGGAATAGGAGAAGG + Intronic
1085300046 11:75452637-75452659 GCTGCTGGAGGGACAGAGGCTGG + Intronic
1085394675 11:76201257-76201279 GCTGACGCTGGGACAGGAGCAGG + Intronic
1085448634 11:76617444-76617466 GGCACTGGGGGGACAGGAGCGGG + Intergenic
1086324568 11:85685416-85685438 GCTGCTTGAGGGTCTGCAGCTGG + Exonic
1086782101 11:90920172-90920194 TCCACTGGATGGACAGGAGCAGG + Intergenic
1088321282 11:108556830-108556852 GCTGCTGGAGGGATTTAAGCAGG - Intronic
1088760282 11:112922761-112922783 GGGGCTGGAGGGAGAGGAGAGGG + Intergenic
1088796602 11:113270891-113270913 GCTGTTGGAGGGACAGTATCTGG - Intronic
1088805850 11:113351458-113351480 GCTACAGGAGGGACAGGTGGAGG + Intronic
1088852387 11:113715533-113715555 TCTGCTGGAGGGACAGGGTTTGG + Intergenic
1089163593 11:116458072-116458094 GCTGGTGGGGGGCCAGGGGCGGG + Intergenic
1089230924 11:116975362-116975384 GCTGGTGGAGGGATAGGAGTGGG - Intronic
1089287278 11:117415705-117415727 GCTGCTGGAGGGCCAAGACAAGG + Intergenic
1089364257 11:117911437-117911459 GCTGCTGCAGGGAGTGGACCTGG - Intronic
1090009551 11:123034167-123034189 GCTGGTGGAGAGACTGGGGCAGG + Intergenic
1090651408 11:128809954-128809976 GCTTTTGGATGGACAGGACCTGG - Intronic
1090777667 11:129979564-129979586 GTTGCTGGGGAGACAGGAACTGG - Intronic
1091003685 11:131932779-131932801 GCTGCAGGAGGTACAGAGGCTGG + Intronic
1091046765 11:132332284-132332306 GCTGCTGAAGAGACAGGTTCCGG + Intronic
1091305392 11:134532878-134532900 GCTGCTGTGGGCACAGGGGCTGG + Intergenic
1091391371 12:128337-128359 GCTGCTGGAAGGATAAGAGACGG + Intronic
1091643769 12:2257537-2257559 GCTGCTGATCTGACAGGAGCTGG + Intronic
1091968208 12:4763633-4763655 GCTGCTGGAGAAACGGGGGCGGG - Intronic
1092241588 12:6839320-6839342 GCTGCAGGAGTCACAGGAGGAGG + Exonic
1092392736 12:8095624-8095646 GCTGGTGTCGTGACAGGAGCAGG - Exonic
1093935255 12:24993942-24993964 GCAGATGGAGGGCCAGGAGGAGG - Exonic
1094494562 12:30981257-30981279 GCTGCTGGAGGGCCGGGTGCTGG - Intronic
1095891174 12:47236002-47236024 GAGGCTGTGGGGACAGGAGCGGG - Exonic
1096148611 12:49295307-49295329 GCTGCTGGAGAAGCGGGAGCTGG - Exonic
1096195839 12:49648315-49648337 GCTGCTGGACGTGAAGGAGCTGG - Exonic
1096243832 12:49973592-49973614 GCACCTGGAGGGCCAGGAGGCGG + Intronic
1096523749 12:52198635-52198657 GCTTCTGGGTGGAGAGGAGCAGG + Intergenic
1098355637 12:69610334-69610356 GCTCCTGGAGGCGCCGGAGCTGG + Exonic
1098954640 12:76677104-76677126 GCTGCCGGAGGATCTGGAGCGGG + Intergenic
1100327182 12:93550788-93550810 ACTCCTGAAAGGACAGGAGCGGG - Intergenic
1101487678 12:105182135-105182157 GCTACTGGAGAGGCTGGAGCAGG - Intronic
1103641366 12:122355198-122355220 GCTGCTGGCGGAACGGGATCTGG - Exonic
1103942543 12:124508884-124508906 GCTGATGGGGGGACAGGAGGTGG + Intronic
1104508594 12:129355900-129355922 CCAGCTAGAGGCACAGGAGCAGG - Intronic
1104538491 12:129640833-129640855 GCTGCTGAGCTGACAGGAGCTGG - Intronic
1104678686 12:130733360-130733382 GCTACTGGAGGGGCTGGGGCAGG + Intergenic
1104864020 12:131942098-131942120 GCTGCTGCAGGAGCAGGGGCAGG + Intronic
1104900839 12:132188844-132188866 GTTGGGGGAGGGAGAGGAGCAGG + Intergenic
1105296209 13:19089802-19089824 CTTGCTGGAGCAACAGGAGCTGG + Intergenic
1105701310 13:22937583-22937605 GCTGCTGGAGGAGGGGGAGCTGG - Intergenic
1105857340 13:24385443-24385465 ATAGATGGAGGGACAGGAGCAGG - Intergenic
1106027465 13:25968602-25968624 GCTGGAGGAGGTGCAGGAGCTGG + Exonic
1110326201 13:74218482-74218504 GGTGCTGGAGGGTGCGGAGCGGG - Intergenic
1111611330 13:90611793-90611815 GGTTCTGGAGGAACAAGAGCTGG - Intergenic
1111860974 13:93705560-93705582 GCAGCTAGAGGGAGAGGAGAGGG + Intronic
1112300212 13:98223126-98223148 GCAGCTGATGGGACAGAAGCAGG + Intronic
1113146058 13:107208884-107208906 TCTGCTGGAGGGGGAGGAGGGGG - Intronic
1113353054 13:109548496-109548518 TCTGATGGAGGGTCAGGAGGAGG - Intergenic
1115398858 14:32937335-32937357 GCCGCGGGAGTGACAGGAGTGGG + Intronic
1117168246 14:53061920-53061942 GCTACTGGGGAGACAGGGGCAGG + Intronic
1117374470 14:55108124-55108146 GCGGGTGGAGGCACAGGAGAAGG + Intergenic
1118951388 14:70439439-70439461 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
1119163380 14:72471706-72471728 GCTGCTGGGTGGTCAGGAGGTGG - Intronic
1119182809 14:72615684-72615706 CCTGGGGCAGGGACAGGAGCAGG + Intergenic
1120818831 14:88893018-88893040 GTGGCTGGAGGGATAGCAGCAGG - Intergenic
1121310415 14:92932629-92932651 GCGGCTGGAGGGGCAGGAGGAGG + Exonic
1121521712 14:94590475-94590497 CCAGTTGGAGGGACAAGAGCTGG + Intronic
1122057974 14:99118003-99118025 GCAGCTGGTGGGACAGGGGAGGG - Intergenic
1122698181 14:103568260-103568282 GCTTCTGGAGGGAGAGATGCTGG + Intronic
1122823558 14:104359067-104359089 GGAGCTGGGGGCACAGGAGCTGG - Intergenic
1122823814 14:104360086-104360108 GCAGGAGTAGGGACAGGAGCTGG - Intergenic
1123158804 14:106257656-106257678 ACTGAGGGCGGGACAGGAGCAGG - Intergenic
1123180135 14:106461565-106461587 GCTCCTGGATGGGCAGAAGCAGG - Intergenic
1123219805 14:106844808-106844830 GCTGCAGGAGGGGCCGGTGCGGG - Intergenic
1123473713 15:20572324-20572346 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1123644296 15:22428029-22428051 GCTGCTGGAGCTGCAGGAGATGG - Intergenic
1123734013 15:23167335-23167357 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1123739883 15:23226181-23226203 GCTGGGGCAGGGACAGGGGCGGG - Intergenic
1123943683 15:25228761-25228783 CCATCTGGAGGGACAGGAGGAGG - Intergenic
1123946095 15:25239631-25239653 GCATCTGCAGGGACAGGAGGAGG - Intergenic
1123980480 15:25597449-25597471 GCTGCTGGTGGAGCAGGAACCGG - Intergenic
1124284516 15:28388646-28388668 GCTGCTGGAGCTGCAGGAGATGG + Exonic
1124291106 15:28455149-28455171 GCTGGGGCAGGGACAGGGGCGGG - Intergenic
1124298181 15:28522968-28522990 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124493644 15:30173538-30173560 GCTCCTGGACGGACAGCAGGGGG - Intergenic
1124612805 15:31220087-31220109 GCTGCTGGTCTGACAGGAGGCGG - Intergenic
1124749923 15:32365111-32365133 GCTCCTGGACGGACAGCAGGGGG + Intergenic
1124959073 15:34381829-34381851 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124975699 15:34528050-34528072 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1125165737 15:36702503-36702525 GGTGAGGGAGGGCCAGGAGCAGG - Intronic
1125336147 15:38628134-38628156 GCTCCTGGAAGGACAAGAGAAGG + Intergenic
1125521674 15:40351356-40351378 GGTGTTTGAGGGACAGGAGTTGG - Intronic
1125609248 15:40959752-40959774 GCTCCTGGAGAGCCAGGAGTCGG + Intergenic
1125722816 15:41853287-41853309 GCGGCAGGAAGGACAGCAGCTGG - Exonic
1125728865 15:41881965-41881987 GCGGCTGGAGGAGCAGGGGCGGG - Exonic
1125763055 15:42111526-42111548 GCTGCTGGGTGAATAGGAGCGGG + Intergenic
1126739317 15:51761620-51761642 GCTACTCGAGGGACTGAAGCAGG + Intronic
1126753798 15:51904584-51904606 GCTCCTGGAGGGACAGCTGCTGG - Intronic
1127793935 15:62422645-62422667 GCTGCTGGAGTGCCAGGAGATGG - Intronic
1127918722 15:63476520-63476542 GCAGCTGGAAGACCAGGAGCAGG + Intergenic
1128446489 15:67766189-67766211 TCTGCTGAAGGGACACAAGCTGG - Intronic
1128562678 15:68678942-68678964 GCTGCTGGAGGGGCAGGGAGGGG - Intronic
1129169221 15:73797734-73797756 GCTGCAGGACTGGCAGGAGCGGG + Intergenic
1129319824 15:74768298-74768320 GCGGCTGGAGGGGAAGGAGATGG - Intergenic
1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG + Intergenic
1129667643 15:77588408-77588430 CCAGCTGGAGGGGCAGGCGCGGG - Intergenic
1129682824 15:77667585-77667607 GCTGATGGTGGGATAGGAGGGGG - Intronic
1129704198 15:77785253-77785275 GCTGCTTGAGGGCCAAGAGAGGG - Intronic
1129921365 15:79322046-79322068 GCTGCGGGAGGCCCAGGACCGGG + Exonic
1130077726 15:80704231-80704253 GCAGCTGGAGAGAGAGGAACAGG - Intronic
1130128785 15:81118461-81118483 GCTGCTTGTGGGACCGGAGCGGG + Intronic
1131482970 15:92797820-92797842 GCTGCTGGAGGGACATGCAGAGG + Intronic
1131753598 15:95536792-95536814 GCTGCTGATCGGACAGGAGGCGG + Intergenic
1131801213 15:96071267-96071289 GCTGGTGGAGGGACAGCGGGTGG + Intergenic
1132117872 15:99150841-99150863 GTTGCTGGTGGGAGAGGTGCAGG - Intronic
1132130734 15:99275990-99276012 GCTGCTGATGGGACAGGAGGTGG - Intronic
1132374845 15:101322226-101322248 GGTGCTGGAGCGAAAGGAGGCGG + Intronic
1132608688 16:804411-804433 GGTCCTGGAAGGACAGAAGCAGG + Intergenic
1132691049 16:1182112-1182134 GCTGTGGCAGGGGCAGGAGCAGG + Intronic
1132838906 16:1968718-1968740 GCCGCAGGAGGGACAGCAGCAGG - Exonic
1132950186 16:2557463-2557485 GCAGCGCGAGGGACAGGAGGAGG + Intronic
1132964160 16:2642707-2642729 GCAGCGCGAGGGACAGGAGGAGG - Intergenic
1132977127 16:2716459-2716481 GGGGTGGGAGGGACAGGAGCCGG - Intronic
1133263846 16:4571217-4571239 GCCACTGGAGGATCAGGAGCAGG - Intronic
1133331406 16:4976888-4976910 CCAACTGTAGGGACAGGAGCCGG + Intronic
1134172107 16:11976854-11976876 GCAGCTGGAGCGGCGGGAGCCGG - Intronic
1134227203 16:12400248-12400270 GCTGGTGCAGGGAGAGGAGTGGG - Intronic
1134247633 16:12551837-12551859 GCTGCTGGGGACACAGGAGCAGG + Intronic
1134388233 16:13794152-13794174 GCTGGAGGAGGGGCAGGGGCTGG - Intergenic
1135281723 16:21158725-21158747 GCTGCTCGGCGGTCAGGAGCAGG + Exonic
1135424244 16:22324448-22324470 GCTGCTGGAGGGGAGGGGGCTGG + Intronic
1135584088 16:23654471-23654493 GGTGCAGGAGGGAAAGGATCGGG + Intronic
1135592063 16:23711995-23712017 GCTCAAGGAGGGACTGGAGCAGG - Intronic
1136104919 16:28023549-28023571 AATGCTGGTGGGACAGGAACTGG - Intronic
1136248716 16:28989846-28989868 TCTGCGGGAGGGGCAGGAGCTGG + Intronic
1136619724 16:31420298-31420320 GGTGGTGGAGGCACAGGGGCAGG + Intronic
1136656842 16:31714394-31714416 TCAACTGAAGGGACAGGAGCAGG - Intronic
1136687329 16:32003029-32003051 GCAGCTGCATGGACAGGAGGTGG - Intergenic
1137613493 16:49834466-49834488 TCTGCTGGAGAGGCTGGAGCCGG - Intronic
1138360974 16:56426591-56426613 GCTACTGGAGAGACTGAAGCAGG - Intergenic
1138455230 16:57117135-57117157 GCTGCCGCAGGGGCAGGAGAAGG + Intronic
1138508179 16:57489420-57489442 GCTGCTGGTCTGACAGGAGGCGG + Intergenic
1139486143 16:67257586-67257608 ACTACTGGAGGGACAGGTGAGGG + Exonic
1139890646 16:70251504-70251526 GCTGCAGGAGGCGCTGGAGCCGG - Exonic
1140457830 16:75115038-75115060 GCTGCTGGGGGGACACCCGCGGG - Intronic
1141003009 16:80325618-80325640 GATGCAGAAAGGACAGGAGCTGG - Intergenic
1141483026 16:84319409-84319431 GCTGCAGGAGGGACACACGCTGG - Exonic
1141505500 16:84475193-84475215 GCTGCGGGAGGGAGAGGATTAGG + Intergenic
1141638791 16:85329437-85329459 GCTGCTGGAAGGATATTAGCCGG + Intergenic
1141804753 16:86335422-86335444 GCTGTTGGAGGGTTCGGAGCAGG - Intergenic
1141948204 16:87324542-87324564 GGTGCTGGAGGGCCAGGGGGAGG - Intronic
1141967532 16:87456398-87456420 GCTGCTGGGGCTACAGGTGCCGG - Intronic
1142080031 16:88144053-88144075 CCTGCTGGGGAGACAGGAGTGGG + Intergenic
1142142901 16:88480446-88480468 GGTGCTGGTGGGGGAGGAGCGGG + Intronic
1142219859 16:88848789-88848811 GCTGCTGGAGGGATGGGCGCTGG + Intronic
1142220674 16:88853487-88853509 GCTGCTGTGGCAACAGGAGCTGG + Intronic
1142608531 17:1095593-1095615 CCTGCTGCAGGGACAAGGGCAGG + Intronic
1142767112 17:2071115-2071137 GCAGCTGGAGTGACAGGGGCTGG + Intronic
1143281435 17:5757649-5757671 CCGGCGGGAGGGACAGGAGGTGG - Intergenic
1143474658 17:7195802-7195824 GCCGCTGGAGAGACGGGGGCAGG + Intronic
1143480672 17:7225989-7226011 ACTGCTGGAGGGACTGGAGGTGG + Exonic
1143535818 17:7538753-7538775 GATGCTGGATGGACAGAACCTGG + Intergenic
1143770207 17:9163765-9163787 GATGCTGGAGGGTGAGAAGCGGG + Intronic
1143778797 17:9218584-9218606 GACGCTGAAGGGACAGGGGCAGG + Intronic
1144739374 17:17572671-17572693 GCTGCGTGAGGGCCAGGGGCCGG + Intronic
1144762570 17:17715656-17715678 ACTGCTGGAAGGTCAGGAGCGGG - Intronic
1145098622 17:20054307-20054329 GCTGCAGGAGAGACAGGAGCTGG - Intronic
1145235309 17:21203758-21203780 GCTGCTGGGTGGTCAGGAGCTGG - Intronic
1145937086 17:28720703-28720725 GCTTTAGGAGGGGCAGGAGCTGG - Exonic
1146884486 17:36462034-36462056 CCTCCTGGAGGGACAGAAGAGGG - Intergenic
1146947229 17:36882144-36882166 GCAGGTGGAGGGACAGGAGGAGG - Intergenic
1147514365 17:41101871-41101893 GCTGCTGGAGATGCAGCAGCTGG + Exonic
1147514817 17:41105753-41105775 GCAGCTGGGGCGACAGCAGCTGG - Exonic
1147515977 17:41117974-41117996 GCAGCTGGGGCGACAGCAGCTGG + Exonic
1147515993 17:41118079-41118101 GCAGCTGGGGCGACAGCAGCTGG + Exonic
1147516584 17:41123673-41123695 GCTGCTGGAGATGCAGCAGCTGG + Exonic
1147517967 17:41140131-41140153 GCAGCTGGGGCGACAGCAGCTGG + Exonic
1147520488 17:41167756-41167778 GCAGCTGGAGATACAGCAGCTGG + Exonic
1147679018 17:42227615-42227637 GCTCCTGGAGGGCCTGGTGCAGG - Exonic
1147686644 17:42289914-42289936 GCTCCTGGAGGGCCTGGTGCAGG + Exonic
1147745294 17:42691090-42691112 GCTAATGGAGGGACAGGGCCTGG + Intronic
1147768905 17:42854548-42854570 GCTGCTGGAGATGGAGGAGCAGG + Exonic
1147971228 17:44219903-44219925 GCTGTGGGAGGGAGCGGAGCCGG - Intronic
1147978076 17:44259279-44259301 GCTGCAGGAGGCAGCGGAGCTGG - Exonic
1148073176 17:44920595-44920617 GTTGGCGGAGGGGCAGGAGCTGG + Intergenic
1148105951 17:45118959-45118981 GCTGCTGAAGCGGCCGGAGCTGG - Exonic
1148206134 17:45781427-45781449 GCTGCTGGCTGGACAGGAAGGGG + Intergenic
1148382388 17:47209477-47209499 GCTGGTGCAGGGGCTGGAGCTGG - Exonic
1148774467 17:50087889-50087911 GCTGGTGGAGGTCCCGGAGCAGG - Intronic
1148791509 17:50175787-50175809 GTTCCAGGAGGGCCAGGAGCTGG - Exonic
1148793187 17:50184980-50185002 GGTGCTGGGCGGGCAGGAGCGGG + Exonic
1148831818 17:50437948-50437970 GCTGCAGGAGGGACAGAAAAGGG - Intronic
1149712597 17:58756429-58756451 GCTGCTGCAGGCACAGGTCCAGG - Exonic
1150266254 17:63834199-63834221 GCTGCAGGATGGGCACGAGCGGG - Exonic
1150426142 17:65078605-65078627 ACTGCTGCAGGGAGAGAAGCGGG - Intergenic
1151318543 17:73338638-73338660 GCTGCTGGGGGGACGGTAGAGGG + Exonic
1151430866 17:74061832-74061854 GCTGCTTAAGGAAAAGGAGCTGG - Intergenic
1151507323 17:74538345-74538367 GCTCCAGGAGGATCAGGAGCAGG + Intergenic
1151513918 17:74580067-74580089 GCTCCAGGAGGAACAGGAACAGG + Exonic
1151675608 17:75595859-75595881 GGGGCTGGAGGGAGAGGAGGTGG + Intergenic
1151718575 17:75843656-75843678 CCTGCTGGGGGAACAGGTGCGGG - Intronic
1151810934 17:76441436-76441458 GCTGCAGGAGGGGCAGGAAAGGG - Intronic
1151895084 17:76974724-76974746 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1151969556 17:77450723-77450745 GAGGCTGGAGAGGCAGGAGCTGG + Intronic
1152109195 17:78347988-78348010 GAGGCCGGAGGGACAGGAGCTGG - Intergenic
1152190336 17:78884101-78884123 GCCGGAGCAGGGACAGGAGCAGG + Intronic
1152269915 17:79318342-79318364 ACTGCTGGGGGCAGAGGAGCTGG + Intronic
1152317253 17:79588416-79588438 GCTCCTGGAGTGGCAGGAGGAGG - Intergenic
1152336028 17:79700608-79700630 GCTCAGGGAGGGACAGGAGGTGG + Intergenic
1152431735 17:80252045-80252067 GGTACGGGAGGGACAGGAGCAGG + Intronic
1152434041 17:80264365-80264387 GCCAGTGGAGAGACAGGAGCGGG + Intronic
1152466925 17:80471731-80471753 GCTGGTGCTGGGCCAGGAGCAGG - Exonic
1152630669 17:81409455-81409477 GGTTCTGGAGGGCCAGGAGCGGG + Intronic
1152914896 17:83029059-83029081 GCTGCCGTGGGGACCGGAGCCGG + Intronic
1152928307 17:83097979-83098001 GGTGCAGGTGGGACAGGACCAGG - Intergenic
1153582952 18:6593832-6593854 GGTGCTGGGGGGTCAGGAGAAGG + Intergenic
1153979595 18:10297673-10297695 GCTTCTGGAGGGGGAGAAGCAGG - Intergenic
1154049030 18:10935796-10935818 GCTGCTGGCGAGGCAGGAGCAGG - Intronic
1155078809 18:22387524-22387546 TCTGCTGGAGTAACAGGTGCTGG + Intergenic
1155993897 18:32309502-32309524 GCTGCTGGGGAGACTGAAGCAGG + Intronic
1156270019 18:35522035-35522057 GCTGCTGGAGTGGCAGGAAGGGG + Intergenic
1156591232 18:38490952-38490974 GGTGCTGGTGGAACAGGGGCAGG - Intergenic
1157479035 18:48040978-48041000 GCTCCTGGTGGTGCAGGAGCAGG - Exonic
1157565164 18:48674890-48674912 GTGGCTGGAGGGAAAGGAGCAGG + Intronic
1157662836 18:49460555-49460577 GCTGCAGGCCGGACCGGAGCCGG - Exonic
1157711624 18:49853625-49853647 GCTGCTGGAGGCTCAGCTGCAGG - Exonic
1157867095 18:51196930-51196952 CCTGCTGGAGGAGGAGGAGCTGG - Exonic
1157946918 18:51990971-51990993 GGTGCTGGAGGTAAGGGAGCAGG - Intergenic
1158588895 18:58763207-58763229 GCTGCTGGTGGCAAAGGAGAGGG + Intergenic
1158893383 18:61893543-61893565 GCTCCTGGAAGGACAGCGGCAGG - Exonic
1159142409 18:64413602-64413624 GCTGCTGGAGAGACTGGGGCAGG + Intergenic
1159153550 18:64553024-64553046 GCTGCTGATGTGACAGGAGGTGG - Intergenic
1159185551 18:64967698-64967720 GTTGCTGGAGAGAGAAGAGCAGG + Intergenic
1159935489 18:74363560-74363582 GCGGGTGGAGGGAGTGGAGCTGG - Intergenic
1160183421 18:76655671-76655693 GGTCCTGGAGGACCAGGAGCAGG - Intergenic
1160701559 19:509989-510011 CCTGCTGGGAGGACGGGAGCAGG - Intronic
1160765816 19:807178-807200 GGAGCTGGAGGGACAGCACCCGG - Intronic
1160827185 19:1086046-1086068 CGTGCTGGAGGGACAGGAGCAGG - Exonic
1160906413 19:1453585-1453607 GCTGCTGGAGGAACTGGACCGGG + Exonic
1161120803 19:2525204-2525226 GCTGTGGGAGGGGCGGGAGCAGG + Intronic
1161125190 19:2552034-2552056 ACTGCTGATGGGACAGGAGGCGG - Intronic
1161293190 19:3506578-3506600 GCTCCTGGAGGGGCCTGAGCTGG - Intronic
1161771651 19:6234091-6234113 GCTGAAGGATGGCCAGGAGCTGG + Intronic
1161937870 19:7383150-7383172 GCAGCTGGAGGGGCCGGAGAAGG - Exonic
1161949475 19:7459884-7459906 GCAGCTGCAGGGAGAGGAGTCGG - Exonic
1161988845 19:7672584-7672606 GCTGCTGGTCTGACAGGAGGTGG + Intergenic
1162364133 19:10237799-10237821 GCTGCTGGATTGAGAGGAGCCGG - Intergenic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1163033989 19:14561244-14561266 GCTGCCTGAGGAAAAGGAGCAGG - Intronic
1163323668 19:16589143-16589165 GGAGCTGGAGGGACAGGAGTGGG + Intronic
1163451342 19:17379158-17379180 TGGGCTGGAGGAACAGGAGCAGG + Intergenic
1163597981 19:18231534-18231556 GCTGCTGGAGGGCCAGGCTGGGG + Intronic
1163655234 19:18541971-18541993 GCTGCTGGGGGGACAGGAATTGG + Exonic
1163747306 19:19056056-19056078 GCTGTGGGAGGGACAGGGACAGG - Intronic
1163799545 19:19356325-19356347 GCTGCTGCAGGGACTGATGCTGG - Exonic
1164051308 19:21587231-21587253 CCTGCTGTCCGGACAGGAGCGGG + Intergenic
1164105350 19:22105378-22105400 GCGGCTGGCGGGCCAGGGGCTGG - Intergenic
1164156983 19:22602983-22603005 GCTGCTGGAGTTGCAGGAGCTGG + Intergenic
1164557956 19:29268209-29268231 GGGGCTTGAGGGACAGGAGCCGG + Intergenic
1164590711 19:29505330-29505352 TCTGGGGGAGGGACAGGAGGAGG + Intergenic
1164846203 19:31434675-31434697 GCTGGTGGAGGGAGAGCATCAGG + Intergenic
1165084005 19:33330011-33330033 GTTGCTGGAGAGAGAGAAGCAGG - Intergenic
1165094208 19:33401800-33401822 GCCGTTGGCGGGAAAGGAGCAGG + Exonic
1165123390 19:33577861-33577883 ACGGCAGGAGGGACAGCAGCAGG + Intergenic
1165210356 19:34230992-34231014 GCTGCTGATGTGACAGGAGGTGG + Intergenic
1165313012 19:35039973-35039995 GCGGCCGGCGGGGCAGGAGCTGG - Intronic
1166060673 19:40323558-40323580 GCTGCTGTGGGGATAGGGGCTGG + Intronic
1166072107 19:40393815-40393837 CCTGCCAGAGAGACAGGAGCAGG + Exonic
1166213970 19:41323895-41323917 TCTGCTGGGGGAGCAGGAGCCGG - Exonic
1166295822 19:41888811-41888833 GCTGCAGGAGGGCCATGAGGTGG - Exonic
1166326050 19:42051824-42051846 GCGGCAGGAGGGGCAGGAGCTGG - Intronic
1166701697 19:44885979-44886001 GAAGCTGGAGGCACAGGAGATGG + Exonic
1166748368 19:45152699-45152721 GCTGCTGGCGGTGCAGGCGCAGG - Exonic
1166781493 19:45345727-45345749 GATGCTGGAGGAAAAGCAGCAGG + Exonic
1166789770 19:45391935-45391957 GGAGCTGGTGGGGCAGGAGCAGG + Exonic
1166898044 19:46036325-46036347 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1166898068 19:46036435-46036457 GCAGCTGCAGGGGCAGGAGGAGG - Intergenic
1166966770 19:46533744-46533766 GATCCTGGAGGGCCTGGAGCAGG + Intronic
1167096274 19:47376511-47376533 GGTGCTGCACGCACAGGAGCTGG + Exonic
1167115424 19:47486793-47486815 GCTGCAGGGGAGAGAGGAGCAGG + Intergenic
1167145998 19:47681072-47681094 GCTGCTGGAGGCCCAGGGGCAGG - Exonic
1167221771 19:48204036-48204058 TCTGCTGGCGGGAGAGGAGTGGG + Intronic
1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG + Exonic
1167594186 19:50418686-50418708 GCTGGAGATGGGACAGGAGCTGG - Intronic
1167663406 19:50809983-50810005 GCTGCTGATGGGACAGGATTTGG + Intergenic
1167667938 19:50833526-50833548 GCTGCTGGAGGATCTGGAGGAGG - Intronic
1167740904 19:51324479-51324501 GCACCTGGAGAGACAGGACCTGG + Intronic
1167810217 19:51823284-51823306 ACAGTGGGAGGGACAGGAGCTGG + Intronic
1167924923 19:52813587-52813609 AGACCTGGAGGGACAGGAGCAGG - Intronic
1168282361 19:55312329-55312351 GGTGGGGGAGGGACGGGAGCTGG + Exonic
1168354846 19:55694736-55694758 GCTGCTGGCAGGAGAGGTGCCGG + Exonic
925216078 2:2096958-2096980 GCCGCTGGCGTGAGAGGAGCTGG - Intronic
925289880 2:2740404-2740426 GCTGATGGAGGAACACCAGCTGG + Intergenic
926053328 2:9758374-9758396 GCTGCTGGAGGAACAGAAAATGG - Intergenic
926314570 2:11699842-11699864 GCTGGGGGAGGGAGAGGAGCCGG + Intronic
926615999 2:14997151-14997173 GAGGATGGAGGGAGAGGAGCAGG + Intergenic
926716380 2:15927574-15927596 GCCGCTGCAAGGACAGGAGTTGG + Intergenic
926892406 2:17649759-17649781 GCTGCAGCGGGGACAGAAGCAGG - Intronic
927419227 2:22912611-22912633 GCAGCTGGAGCGCCAGAAGCAGG + Intergenic
927484050 2:23476966-23476988 GCTACTGAAGGGACAGGAGCTGG + Intronic
927679640 2:25131346-25131368 GCTGCGGGAGGAAGATGAGCTGG - Exonic
927706639 2:25300228-25300250 CCTGCAGGACGGAGAGGAGCAGG - Exonic
928115432 2:28542600-28542622 GCAGGGGGAGGGACAAGAGCTGG - Intronic
928203117 2:29264002-29264024 GCTGTTTGAGAGACAGCAGCAGG - Intronic
928245766 2:29625774-29625796 GCTGCTGGAGGGCCAGGCTCTGG + Intronic
928515304 2:32039420-32039442 GATGCTGGAGGGACAAACGCAGG - Exonic
929848188 2:45555062-45555084 GATCGTGGAGGGAAAGGAGCTGG - Intronic
929895884 2:45960572-45960594 GCTGCTGGTCTGACAGGAGGTGG + Intronic
931431851 2:62214798-62214820 GCATCTGGAGTGACAGGACCAGG - Intronic
932143190 2:69297368-69297390 GCTGCTGCAGACAGAGGAGCCGG - Intergenic
932598824 2:73110786-73110808 GGTGCTGGGGGAACAGGAGGAGG - Intronic
932763711 2:74457429-74457451 GCTGCTGAAGCGCGAGGAGCGGG + Exonic
933730152 2:85450296-85450318 GCTGCTGGAGGGAGAAGAACAGG + Intergenic
934613993 2:95760298-95760320 GCAGCTGCAGGGAGGGGAGCTGG - Intergenic
934763851 2:96869768-96869790 GACGCGGGAGGGACAGGGGCTGG - Intronic
934774410 2:96927993-96928015 GCTCCGGGAGGGAAAGGGGCAGG + Intronic
935173091 2:100625968-100625990 GCTGTTGGAGGGCTTGGAGCAGG + Intergenic
935971524 2:108534453-108534475 GCTACTGGCGGGCCCGGAGCAGG - Intronic
936258367 2:110936003-110936025 GCTGCTGAACTGACAGGAGGTGG + Intronic
936636563 2:114265480-114265502 GCTGAAGGAGTGACAGGTGCAGG + Intergenic
937208386 2:120251868-120251890 GCTGATGGAGGGACTGGATCTGG + Intronic
939914305 2:148020909-148020931 GTAGCGGGAGGTACAGGAGCGGG - Intronic
940420946 2:153478621-153478643 GGCGCTGGAGGAACAGGTGCCGG + Exonic
940739314 2:157489025-157489047 GCAGCTGGAGGAAGAGGAGGAGG + Intergenic
941403781 2:165063549-165063571 GCTGCTGATGGGACAGGAGGTGG + Intergenic
942420425 2:175801491-175801513 GCTACTGAAGTGACAGGAGGTGG + Intergenic
943064002 2:183068674-183068696 GCTGCAGGAGGGATAGGGGGTGG + Intergenic
944302770 2:198143309-198143331 GCTGCTGATGTGACAGGAGTGGG + Intronic
944402915 2:199348880-199348902 GATGCTGGTGAGCCAGGAGCCGG + Exonic
944766716 2:202871709-202871731 GCTGCCGGAGGGCCGGGAGTCGG - Intronic
944772200 2:202925750-202925772 GCTGCTTGAGTAACAGGAGCTGG + Intronic
945429196 2:209745026-209745048 GCTGCTTGAGAGACTGAAGCAGG - Intergenic
946023698 2:216659206-216659228 GCTGCTGGAGTGCCAGCACCCGG + Intronic
946331736 2:219013449-219013471 GGGGCTGGCTGGACAGGAGCAGG - Intronic
946389896 2:219408947-219408969 GCTGCTGGAGGGAGGGGCTCTGG + Intergenic
947354678 2:229279793-229279815 GCTGCAGGAGGGAGAGCACCAGG + Intergenic
947724247 2:232387559-232387581 GCTGCGGGAAGGACAGAGGCAGG + Intergenic
947866684 2:233402636-233402658 GCTGCCGGCCGGACATGAGCTGG - Intronic
948257351 2:236577890-236577912 GCAGCAGCAGGGACAGCAGCTGG - Intronic
948388993 2:237598633-237598655 GATGCTGGAGGGGACGGAGCAGG - Intronic
948786106 2:240353764-240353786 GCGGCTGGAAGGACAAGCGCTGG - Intergenic
948796723 2:240407020-240407042 GCTGCTGGAGGGACTGAGGCAGG + Intergenic
948907605 2:240987146-240987168 GCTGCTGGGGGTGGAGGAGCAGG + Intronic
949079775 2:242087991-242088013 GCGGCTGGAGGGAGAGAGGCAGG - Intergenic
1168973606 20:1947620-1947642 GCTGATGGAGGGCCTCGAGCTGG + Intergenic
1169746908 20:8952065-8952087 CCCACTGGAGGGAAAGGAGCTGG - Intronic
1171087072 20:22247341-22247363 GATGCTGGAGCCACAGTAGCAGG + Intergenic
1171188201 20:23138447-23138469 GCTCCTGGCAGGACAGGTGCTGG + Intergenic
1171345416 20:24462137-24462159 GCTGTTGGGGGCACAGGAGCAGG - Intergenic
1171881745 20:30622353-30622375 GGAGCAGGAGGGTCAGGAGCAGG - Intergenic
1172027153 20:31956454-31956476 GCTGCTGGAGGGTGCTGAGCAGG + Intergenic
1172038723 20:32028934-32028956 CCTGCCTGAGGGCCAGGAGCTGG + Intronic
1172390164 20:34560340-34560362 GCGGCTGGAGGCACAGGGCCAGG - Exonic
1172504565 20:35452001-35452023 GCTGCTGAACTGACAGGAGGTGG - Intronic
1172555924 20:35841246-35841268 GAGGCTGGAGGGACACGAGCTGG + Intronic
1172764242 20:37342693-37342715 GCTTGTGGAGGGACAGCAGGAGG + Intergenic
1173258682 20:41413838-41413860 AGTGCTGTGGGGACAGGAGCTGG - Intronic
1173870139 20:46336455-46336477 GTGGGAGGAGGGACAGGAGCAGG + Intergenic
1174109738 20:48190285-48190307 GCTGCAGCAGGTACAGGAGTGGG - Intergenic
1174194853 20:48765922-48765944 GCTGCTGATGTGACAGGAGGCGG - Intronic
1174295159 20:49540441-49540463 GCTGGTGCAGGCACTGGAGCCGG + Intronic
1174354261 20:49987881-49987903 GCTGCAGTGGGGACAGGAGAAGG - Exonic
1175199325 20:57266849-57266871 GCGGCTGGAGGAATCGGAGCCGG + Intergenic
1175392170 20:58634414-58634436 TCTGCTGGATGGGCAGGAGCCGG - Intergenic
1175448539 20:59042988-59043010 GCAGCTGGAGGGGCCGGCGCGGG + Intergenic
1175465834 20:59191074-59191096 GCCCCTGGAGGGCCAGGAGTGGG - Exonic
1175692963 20:61079283-61079305 GCGGCAGGAGGGTCAGGAGGGGG - Intergenic
1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG + Exonic
1176008127 20:62877189-62877211 GCGGCTGCAGGGACAGGCTCGGG - Intergenic
1176099794 20:63359728-63359750 GGTGCAGGCGGGACAGGAGCCGG + Intronic
1176284501 21:5012367-5012389 GCTGCTGGAGGGACAGGGGCAGG + Intergenic
1176597368 21:8759324-8759346 GGTTCTAGAGGCACAGGAGCGGG + Intergenic
1177041381 21:16115515-16115537 GCTGTTTGAGATACAGGAGCTGG + Intergenic
1178513801 21:33229833-33229855 GCCGCTGGCGGGGCTGGAGCAGG - Intergenic
1179086823 21:38225723-38225745 GCTTCTGGAGTGACCAGAGCAGG + Intronic
1179643999 21:42764463-42764485 GCTCCTCCAGGGACAGGACCTGG + Intronic
1179658874 21:42862252-42862274 TCTGCTGGAGGGGCAGGAAGGGG + Intronic
1179793404 21:43768526-43768548 CCGGCTGGAAGGACAAGAGCGGG - Intergenic
1179812038 21:43877954-43877976 GCTGGTGGTGGGGCAGGAGGCGG - Intronic
1179831607 21:44000541-44000563 GCTGGTGCAGGGACAGCAGTGGG - Intergenic
1179872680 21:44251108-44251130 GCTGCTGGAGGGACAGGGGCAGG - Intronic
1179936975 21:44612258-44612280 GCAGCTGGAGGCACAGGAGCGGG - Exonic
1179974460 21:44856261-44856283 GCTGCAGGAGGAAGAGGAGCCGG - Exonic
1179993228 21:44959461-44959483 TTTGCTGGGGGGACAGGGGCAGG - Intronic
1180049968 21:45326604-45326626 GATGCTGTGGGGGCAGGAGCAGG - Intergenic
1180055470 21:45356814-45356836 GCTTTGGGAGAGACAGGAGCAGG - Intergenic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181088776 22:20457951-20457973 CCTGCTGCAGGGACTGGATCTGG + Exonic
1182422009 22:30253339-30253361 GGGGCTGGAGGGTGAGGAGCAGG - Intergenic
1182519553 22:30877719-30877741 GGGACTGGAGGGACAGCAGCAGG - Intronic
1182576899 22:31278950-31278972 GCTCCAGGAAGGACAGGATCTGG - Intronic
1182693709 22:32181700-32181722 TCTGCTGGAGTGACTGGAGGAGG - Intergenic
1182867263 22:33614597-33614619 CCTGCAGGAGGAGCAGGAGCTGG - Intronic
1183398210 22:37585414-37585436 GGTCCTGGAGGGACACTAGCTGG - Intergenic
1183411734 22:37658908-37658930 GCTGCTGGAGCGGCTGGCGCGGG + Exonic
1184274799 22:43404205-43404227 GGTGGGGGAGGGACAGAAGCTGG - Intergenic
1184660272 22:45962439-45962461 GCCCCTGGAGGGGGAGGAGCTGG - Intronic
1184825443 22:46947497-46947519 CCTGCTGGTGGGACAGAGGCAGG + Intronic
1184993079 22:48183616-48183638 GAGGCTGGAGGAAGAGGAGCAGG - Intergenic
1185206172 22:49540409-49540431 GATGCAGGAGGGAAAGCAGCAGG - Intronic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
1203295526 22_KI270736v1_random:39770-39792 GCAGCTGAAGGAACAGGAGGTGG - Intergenic
949518353 3:4827183-4827205 GGTGCTGTCGGGGCAGGAGCAGG - Intronic
949580996 3:5388182-5388204 GTGGCTGGAGAGATAGGAGCTGG + Intergenic
950181848 3:10918938-10918960 GCTGGTGGGGCCACAGGAGCCGG - Intronic
950298268 3:11850832-11850854 GCTGATGGAGGGGAAGGAGAGGG + Intergenic
950441607 3:13014077-13014099 GCTGCTGGAGGTAGCTGAGCTGG + Intronic
951355764 3:21664980-21665002 GCTGGTGGACGGACAAGGGCCGG + Exonic
952155805 3:30642254-30642276 GCTGCTGAGGGGACAGCACCTGG - Intronic
952312497 3:32202780-32202802 GCTGCTGGAGGGAGAGCAGCTGG - Intergenic
952810220 3:37396079-37396101 GCTGGTGGAAGGACAGGAGTAGG - Intronic
952858928 3:37796016-37796038 TATGCTGGAGAGACAGGAGCTGG - Intronic
952888963 3:38028792-38028814 GCTGCTGGAGGGACAGCGAAAGG + Intronic
953041409 3:39257917-39257939 GCCTCTGCATGGACAGGAGCTGG + Intergenic
953389759 3:42527371-42527393 GCTGTTGGAGGGACAGGGAGAGG - Exonic
953391197 3:42534879-42534901 GCAGCTGGAGGCACAGAAGATGG - Intronic
953980081 3:47409224-47409246 GCTGCTCCAGGGACACGCGCTGG - Exonic
954005621 3:47588222-47588244 GAGGCTGGCGGGCCAGGAGCAGG + Exonic
954034356 3:47842944-47842966 GCTGCTGCATAGCCAGGAGCAGG - Intronic
954138136 3:48591700-48591722 TCTGCTGGAGGGCCACGAGGTGG - Exonic
954707606 3:52489397-52489419 GCTGCTGCAGGGGCTGGAGCTGG - Exonic
955067190 3:55543704-55543726 TCTGGAGGAGGGTCAGGAGCTGG + Intronic
955399026 3:58578006-58578028 GCTGCTGAAGGGGCTGGTGCTGG - Intronic
956646966 3:71465824-71465846 GCTGCTGATGTGACAGGAGGCGG - Intronic
956743053 3:72289907-72289929 GCTGCTTGAGGGAAGGGAGTGGG - Intergenic
959863780 3:111243302-111243324 GCTCTTGGGGGGCCAGGAGCAGG - Intronic
961133902 3:124492887-124492909 AGTGCTGGAGGGAGAGGTGCTGG - Intronic
961554817 3:127690547-127690569 GCTGCTGGAGGAAGAAGGGCGGG + Exonic
961920305 3:130418374-130418396 GCTGCCGAAAGGAAAGGAGCAGG - Intronic
962151801 3:132901860-132901882 GCTGCTGGGGGTAGAGGAGGGGG - Intergenic
962693189 3:137921821-137921843 GCTGCTTGAAGGACAGGAGAAGG - Intergenic
962703968 3:138025949-138025971 CCTGCCTGTGGGACAGGAGCTGG - Intronic
962854013 3:139328403-139328425 GCTGCTGGAGGGACCTGTCCAGG + Intronic
962889519 3:139658931-139658953 GCTGCTTGAGGGAGGGGTGCAGG - Intronic
963190408 3:142464694-142464716 GCTGCTGGAGGCTGAGGAGAAGG + Intronic
965363847 3:167774618-167774640 GCTGCTGGTCTGACAGGAGGTGG - Intronic
965385037 3:168035646-168035668 GAAGGTGGAGGGAGAGGAGCAGG + Intronic
966156376 3:176920857-176920879 GCTGCTCCAGGGAAGGGAGCTGG + Intergenic
966425492 3:179775841-179775863 GCAGGTGGAGGGAGAGGCGCAGG - Intronic
966558035 3:181285713-181285735 GCTGCTGGGGTTAAAGGAGCCGG - Intergenic
967281222 3:187825923-187825945 GCTGCTGGGGAAACAGGAGCAGG - Intergenic
968262551 3:197336810-197336832 GCTGGTGGAGGGATAGGGGCTGG + Intergenic
968658921 4:1791028-1791050 GCTACTGGAGGGAGAGGTGGTGG + Intergenic
968969859 4:3788164-3788186 GGGGCAGGAGGGGCAGGAGCTGG - Intergenic
969046455 4:4340117-4340139 CCTGCTGGAGGGAGGGGTGCAGG - Intergenic
969203278 4:5622649-5622671 GCAGCTGGAGGGGGAGGAGAGGG - Exonic
969355634 4:6623788-6623810 GGTGCTGGAGGGACCGCAGGGGG - Intergenic
969411593 4:7031951-7031973 GCTCCTCGAGGTGCAGGAGCAGG + Exonic
969458329 4:7313778-7313800 GCTGCTGGAGGGTTCTGAGCAGG - Intronic
969580419 4:8061392-8061414 GGAGCGGGAGGGACAGGAGGAGG + Intronic
969583407 4:8078414-8078436 TCTGCTGGAGGGGCAGGCCCAGG - Intronic
969626086 4:8306485-8306507 GCAGTAGGAGGGGCAGGAGCAGG - Exonic
969791184 4:9494843-9494865 GCTGCTGGTAGGACAGAGGCTGG + Intergenic
970291504 4:14577849-14577871 GTTGGAGGAGGGAGAGGAGCAGG + Intergenic
970645167 4:18111581-18111603 GCTACTGGAGGGCCTGGAGAAGG - Intergenic
970664307 4:18319337-18319359 GGTGCTGGGGGAGCAGGAGCGGG + Intergenic
972252822 4:37322495-37322517 GCTTCTGGAGGGACATAAACAGG + Intronic
972480185 4:39489304-39489326 GCTTCTGGAGTGACTAGAGCAGG - Intergenic
972562799 4:40243590-40243612 CCTGCTGGTAGGACAGGGGCCGG - Exonic
972629191 4:40828874-40828896 CCTGAGGGAGGGACAGGGGCAGG - Intronic
973360663 4:49161543-49161565 GGTTCTAGAGGCACAGGAGCGGG + Intergenic
974640405 4:64623431-64623453 GCAGCTACAGGGAAAGGAGCAGG - Intergenic
975646169 4:76548199-76548221 GCCGCTGGAAGGCCAGGGGCTGG + Intronic
975824815 4:78308484-78308506 ACAGCTGGAGGGAAAGGAGCTGG + Intronic
976096480 4:81513468-81513490 GCAGCTGGGGGCACAGGAACAGG + Intronic
976622322 4:87141702-87141724 CCGGCTGGAGGGTCAGCAGCTGG - Intergenic
979077643 4:116294292-116294314 GCAGGAGGAGGAACAGGAGCAGG + Intergenic
980774990 4:137425955-137425977 TCTGCTGGTGGGACAGGTCCTGG + Intergenic
981751404 4:148095667-148095689 GCTGATGGAGTGACAGAGGCAGG + Intronic
982235621 4:153249025-153249047 GTTGCTGGAGGGCCAGGCGGGGG + Intronic
982744107 4:159088437-159088459 GCTGGGGGAAGGAAAGGAGCAGG + Intergenic
982767875 4:159368741-159368763 GCTGCTGGTCTGACAGGAGACGG - Intergenic
982918900 4:161249794-161249816 GCTCCTGGCTGGAAAGGAGCAGG - Intergenic
983666350 4:170188775-170188797 ACAGCTGCAGGGACTGGAGCTGG + Intergenic
983831347 4:172331535-172331557 GTGGATAGAGGGACAGGAGCTGG - Intronic
985060119 4:186069662-186069684 GCTGGAGGGGAGACAGGAGCTGG + Intronic
985529228 5:424087-424109 CCTGGTGGAGGGACGGGGGCCGG + Intronic
985693375 5:1325934-1325956 GCTGTGGGAGGGACAGGAAGAGG - Intronic
985950781 5:3220114-3220136 GATGGAGGAGGGAGAGGAGCAGG - Intergenic
986607420 5:9536020-9536042 GCTGCTGCTATGACAGGAGCAGG - Intronic
987905069 5:24066312-24066334 GCAGGAGGAGGGAGAGGAGCAGG - Intronic
988100460 5:26669800-26669822 GCAGCTGAAGGTGCAGGAGCTGG - Intergenic
990868322 5:60403758-60403780 CCTGCTGGAGAGACAGCATCAGG - Intronic
991098182 5:62761866-62761888 GGTGTTGGAGGAACAGGAACTGG + Intergenic
991418933 5:66421159-66421181 TCTGCTGGAGGGACAGAGGGAGG + Intergenic
991593609 5:68279679-68279701 GCTGCTGGAATGACAGGATTTGG - Exonic
992366086 5:76091404-76091426 GTTGCTGCAGGGACCAGAGCAGG - Intronic
992614230 5:78534179-78534201 CCTCCTGGAGGGACAGCAGAGGG + Intronic
994631811 5:102296367-102296389 GAGGCTGGAGGGCCAGGAGGCGG - Exonic
994985184 5:106924098-106924120 GCTGCTGGTCTGACAGGAGGTGG - Intergenic
995745057 5:115394167-115394189 GCTCTTGGGGGGCCAGGAGCAGG - Intergenic
996749826 5:126877187-126877209 GCAGCTGGAGGAACAGGGTCTGG + Intronic
996885390 5:128347888-128347910 GCTACTCGAGGGACTGAAGCAGG - Intronic
997212459 5:132085497-132085519 GCTGCTGTGGGGAGAGAAGCAGG - Intergenic
997375319 5:133393596-133393618 GCAACTGGAGGGACAGGAAAGGG + Intronic
997521302 5:134525944-134525966 GCCGCTGCAGGGACCGGCGCGGG - Intronic
997566688 5:134893389-134893411 GCTGCTCCAGGGAGAGGAACGGG - Intronic
997740888 5:136252769-136252791 GCTGCTGATCTGACAGGAGCTGG + Intronic
997882730 5:137604777-137604799 GCTGCTGGAGAGTGCGGAGCTGG - Intergenic
998040170 5:138946528-138946550 GCTGCTGGAGTGATGGGTGCTGG - Intergenic
998385900 5:141756977-141756999 GGTGCGGGAGTGTCAGGAGCAGG - Intergenic
998629244 5:143880258-143880280 GAAGCTGGAGAGACTGGAGCAGG + Intergenic
999376426 5:151089581-151089603 GGAGCTGGAGCGACATGAGCTGG + Intronic
999447560 5:151652265-151652287 GCCGTTGGTGGGGCAGGAGCTGG + Intergenic
1000125707 5:158241785-158241807 GCTGCTGGAGGGTTTTGAGCAGG + Intergenic
1000672630 5:164081086-164081108 GCTATGGGAGGGCCAGGAGCAGG - Intergenic
1001245086 5:170100194-170100216 GCTGCTGCAGGGACTGGATGAGG - Intergenic
1002106223 5:176880604-176880626 GCTGGGGGAGGGGCAGGGGCAGG - Exonic
1002123358 5:177022810-177022832 GTTGCTGGAGGGCCAGGAGCCGG + Exonic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1002453230 5:179331391-179331413 GAAGCTGGAGGGAGAGGAGGGGG + Intronic
1002560486 5:180078595-180078617 GCTGCTGATGTGACAGGAGGTGG - Intergenic
1003142677 6:3484754-3484776 GCTGCTGGAGGTACAGTGCCAGG + Intergenic
1004517343 6:16331502-16331524 GCTGCAGGAGGGCCAGCAGGGGG - Intronic
1005858634 6:29884368-29884390 GCTGCTTGTGGCACAGCAGCTGG - Intergenic
1005871094 6:29974916-29974938 GAGGCAGGAGGGACGGGAGCAGG + Intergenic
1005873451 6:29994515-29994537 CCTGCTGGAAGGGCAGGAGGGGG - Intergenic
1006163386 6:32050543-32050565 GGTGCTGGAGGGACAGGGAGAGG - Intronic
1006164006 6:32053933-32053955 GGTGCTGGAGGGACAGGGAGAGG - Intronic
1006164634 6:32057131-32057153 GGTGCTGGAGGGACAGGGAGAGG - Intronic
1006277104 6:33013819-33013841 CCTGCTGGAGTGGGAGGAGCTGG - Intergenic
1006727643 6:36211319-36211341 GCTGCTGGAGAAACTGGACCTGG + Exonic
1006749319 6:36366689-36366711 GCCGCTGGAGAGCCAGGAGCAGG - Exonic
1007357784 6:41333655-41333677 TCTGCAGGAGGGACTGGGGCAGG - Intergenic
1007371509 6:41429238-41429260 GCGGCTGCAGGGACAGGAAGTGG - Intergenic
1007373812 6:41443219-41443241 GCACCTGGAGAAACAGGAGCTGG + Intergenic
1007414973 6:41686225-41686247 GCTGCTGCAGGGACGTGCGCTGG - Exonic
1007765752 6:44158887-44158909 CCTGCAGGAGGTACAGGAGTGGG - Intronic
1008288189 6:49680132-49680154 GATGCAGGAGGGAGAGGATCAGG - Intergenic
1010770443 6:79822449-79822471 GGTGCTGGAGGGAGAAGAGGAGG + Intergenic
1010985134 6:82414851-82414873 GCTGCTGGAGGAGCAGCAGTGGG + Intergenic
1011111967 6:83848785-83848807 GCTTCTGAAGAGACAGGGGCTGG - Intergenic
1013226368 6:108121649-108121671 GAAGCTGGAAGGAAAGGAGCTGG - Intronic
1013411531 6:109888148-109888170 GCTTCTGGGGTGACTGGAGCAGG + Intergenic
1013627999 6:111956792-111956814 GGAGCTGGAAGGACAGGAGGTGG + Intergenic
1014308440 6:119770175-119770197 GCAGCTGGAGGGACAGAAACCGG + Intergenic
1015275045 6:131375521-131375543 ACTGCTGGAGGGCCAGAAGCTGG - Intergenic
1015544937 6:134352161-134352183 GCAGCTGGAGGGCTAGGAGCTGG - Intergenic
1015857520 6:137640949-137640971 CCTGTGGGAGGCACAGGAGCAGG - Intergenic
1015924016 6:138291922-138291944 GGTCCTGGATGGACAGGGGCTGG - Exonic
1016735947 6:147480395-147480417 GCTGCGGGAGGGACAGCATTAGG - Intergenic
1016986033 6:149896590-149896612 GCTGCTGTGGGGACACCAGCGGG + Intronic
1016999363 6:149985395-149985417 GTTGCTGGAGGAACAGGATGTGG + Intergenic
1017007688 6:150039641-150039663 GCAGGAGGAGGGACAGGAGGTGG - Intergenic
1017446336 6:154510293-154510315 GCAGCTGGAGGGAGAGGGCCGGG - Exonic
1017506334 6:155072111-155072133 GTGGCTGGGAGGACAGGAGCTGG + Intronic
1017511824 6:155121490-155121512 GCTGTTTGAGAGACAGAAGCAGG + Intronic
1017651843 6:156590678-156590700 TCTGCTGGAGGGACTGGGTCGGG + Intergenic
1017950271 6:159130240-159130262 GCTGATGGTGGGGCAGGGGCAGG - Intergenic
1018152334 6:160951925-160951947 ACGGCTGGAGAGACAGGAGCAGG + Intergenic
1018480985 6:164190104-164190126 TGTGCTGGAGGAACAAGAGCAGG - Intergenic
1018894343 6:168002967-168002989 GCTGCTGGTCTGACAGGAGGTGG + Intronic
1019064669 6:169287209-169287231 CCTGCAGGAGGGACAGCAGAGGG + Intergenic
1019417455 7:934081-934103 GGTGCTGGAGAGCCGGGAGCCGG + Intronic
1019417526 7:934291-934313 GGTGCTGGAGAGCCGGGAGCCGG + Intronic
1019530095 7:1498998-1499020 GCTGCTGGCGGTGCAGAAGCTGG - Exonic
1019539804 7:1546525-1546547 GCAGCTGGAGGGAGGGGCGCCGG - Exonic
1019568627 7:1697365-1697387 GCTGCTGGAGGGGCCTGTGCAGG + Intronic
1019709506 7:2511811-2511833 GCTGCGGCAGGGGCAGGGGCTGG - Intergenic
1019743650 7:2688066-2688088 GCAGCTGGAGGGAGTGGGGCAGG + Intronic
1020057760 7:5129962-5129984 GCAGCTGGGAGGAGAGGAGCTGG + Intergenic
1020122591 7:5513487-5513509 GATGCGGGAAGGACGGGAGCAGG + Intronic
1020275893 7:6624177-6624199 GCAGCTGGGGGGAGAGGGGCAGG - Exonic
1020724626 7:11795765-11795787 GCTGCTGGAGGAAGAGGCCCTGG + Intronic
1020920701 7:14260442-14260464 GCTGCTGGATGATCAGCAGCAGG - Intronic
1021206422 7:17786627-17786649 CCTGCTGGAAGGGCAGGAGGGGG + Intergenic
1022094551 7:27130562-27130584 GCTGCTGCAGCGGCAGGTGCTGG + Exonic
1022104757 7:27189800-27189822 ACTGTAGGGGGGACAGGAGCAGG - Intergenic
1022114631 7:27251495-27251517 GCTCCCCGAGGGAAAGGAGCGGG + Intergenic
1022976729 7:35565457-35565479 GCTGCTCCAGGGACAGGATCTGG + Intergenic
1023191274 7:37585606-37585628 GCTGGTGTTGTGACAGGAGCAGG + Intergenic
1023583435 7:41705271-41705293 GCTGCTCAAGGTACAGTAGCAGG - Intergenic
1023780104 7:43647470-43647492 TCTGATGGAGGAGCAGGAGCAGG + Intronic
1023862364 7:44224348-44224370 CCTGATGGAGGGAAAGGAGGGGG + Intronic
1024520377 7:50300596-50300618 GCTGCTGGGGGTGAAGGAGCAGG - Intergenic
1024800964 7:53077561-53077583 GCTGCAGGAGAGACTGGAGGAGG + Intergenic
1024947942 7:54830478-54830500 GGGGCTGGAGGGAGAGGAGAAGG + Intergenic
1024988049 7:55212992-55213014 GCTGGTGGAGGGAAAGGCGCCGG - Intronic
1025258288 7:57399841-57399863 GCTGCAGGAGCCGCAGGAGCTGG + Intergenic
1025610347 7:63071889-63071911 GCTGCAGGAGCTGCAGGAGCTGG - Intergenic
1025731550 7:64113042-64113064 GCTGAGGGAGGGACATGACCTGG - Intronic
1025813300 7:64888949-64888971 GCGGCTGGGTGGACAGGGGCTGG - Intronic
1026447611 7:70499239-70499261 CCTGCTGAAGGGAAAGGAGAAGG + Intronic
1026797264 7:73374325-73374347 GCTGCTGGAGAGGCTGAAGCGGG + Intergenic
1026981544 7:74529671-74529693 GCTGCTGGACACACAGGACCCGG - Intronic
1027232990 7:76282764-76282786 GCGGCTGGAGCTCCAGGAGCGGG - Exonic
1027265724 7:76494251-76494273 GGGGCAGGAGGGAGAGGAGCTGG + Intronic
1027317095 7:76992368-76992390 GGGGCAGGAGGGAGAGGAGCTGG + Intergenic
1028613473 7:92738169-92738191 TCTGCTGGAGGAAGAGGATCTGG + Intronic
1029297621 7:99553977-99553999 GCTGCTGGAGGCAAAGTAGTTGG + Intronic
1029595505 7:101535560-101535582 GCTGCTGGAGGCCATGGAGCTGG - Intronic
1029705567 7:102274089-102274111 GCTGCAGGAGGGCCCGGACCTGG - Intronic
1029923198 7:104287840-104287862 GAGGCTGGAGGGTCAGGAGTTGG - Intergenic
1030216015 7:107044652-107044674 GCGGCTGGAGCGGGAGGAGCAGG + Exonic
1030454307 7:109753986-109754008 GATATTTGAGGGACAGGAGCAGG - Intergenic
1031001415 7:116419684-116419706 GCTTCTGGAGGTACATGTGCAGG - Intronic
1031596870 7:123658973-123658995 GATGCTGCAGGGGCAGGAGTTGG - Intronic
1032085294 7:128880525-128880547 GGAGCTGAAGGGATAGGAGCTGG + Exonic
1032692584 7:134303893-134303915 GGAGCAGGGGGGACAGGAGCAGG - Intronic
1033145843 7:138869469-138869491 GCTGCGGGGGGCACAGGAGCAGG - Intronic
1033421680 7:141209675-141209697 GCTGCAGGAAGGACAGAAGCAGG + Intronic
1034276954 7:149828072-149828094 GCTGCTGCAGGGCCTGGAGTAGG - Intergenic
1034408296 7:150921288-150921310 GATGCTGGAGGGACATTCGCAGG - Intergenic
1034672198 7:152867290-152867312 GCTCCTGGGGGCACGGGAGCAGG + Intergenic
1034926887 7:155129833-155129855 ACTGCTGGAAGGACAGGAGGTGG + Intergenic
1034940035 7:155224765-155224787 GCTGCTGGGGAGACGGTAGCAGG + Intergenic
1035168042 7:157003209-157003231 CCTGCTGGAGGCGCAGGGGCCGG + Intronic
1035537826 8:406276-406298 GCGGCTGGAGGGAGAGAGGCAGG - Intergenic
1036033388 8:4994717-4994739 GCTGCGGGAGGGGGAGAAGCGGG + Exonic
1036226261 8:6960259-6960281 GATGCTGCAGTGACAGGAGGTGG + Intergenic
1037584758 8:20268768-20268790 GCTGCTGGTGGGTTGGGAGCAGG + Intronic
1037789007 8:21920014-21920036 GGGGCTGCAGGGACAGGAACGGG + Intronic
1039070716 8:33647176-33647198 GCTGCTGGTCTGACAGGAGGCGG + Intergenic
1039884699 8:41648318-41648340 TCTGCAGGAGGGAGAGGGGCAGG - Intronic
1041162994 8:55063657-55063679 GCAGGTGGAGGGGCAGGACCAGG + Intergenic
1041368104 8:57130662-57130684 GCTGAGGGAGGGGAAGGAGCAGG - Intergenic
1041706681 8:60853520-60853542 GCTGCTGCAGGGTCAGGAGAGGG - Intronic
1042354840 8:67815674-67815696 GCTGGTGCAGGGAGTGGAGCGGG + Intergenic
1042928466 8:73990507-73990529 GCTGCTGGTCTGACAGGAGCTGG - Intergenic
1042999637 8:74742125-74742147 GCAACTGGGGGGACAGGAGGTGG - Intronic
1043001685 8:74767573-74767595 GCTGATGCAGGGAAAGGACCTGG + Intronic
1043120555 8:76317600-76317622 TCTGCTTGTGGGACAGAAGCTGG + Intergenic
1043863046 8:85343527-85343549 GCTCATGGAGTGACAGGAGCAGG + Intronic
1043982422 8:86657724-86657746 GCTGCAGGAGCTGCAGGAGCTGG - Intronic
1045343807 8:101276601-101276623 ACTGATGGAGGCACAGGAGTTGG + Intergenic
1045484685 8:102621904-102621926 GCTGCAGGAGTGGCAGAAGCTGG - Intergenic
1045558899 8:103241596-103241618 TCAGCTGGAGGGAGAGGGGCAGG + Intergenic
1045674186 8:104589418-104589440 GCTGCTGGATGCCCAGGGGCTGG + Intergenic
1047200790 8:122764512-122764534 GCTGGAGGAGGGAGAGGATCAGG + Intergenic
1047715422 8:127590767-127590789 GGGAGTGGAGGGACAGGAGCTGG - Intergenic
1047807236 8:128373210-128373232 GCTGCTGGAGATGCAGGTGCTGG + Intergenic
1047807257 8:128373393-128373415 GCTGCTGGTGGTACTGGTGCTGG + Intergenic
1048179198 8:132179972-132179994 GCTGGGGTAGGGGCAGGAGCAGG - Intronic
1048592551 8:135834184-135834206 CCTGATGGAGGGAGAGGAGCTGG + Intergenic
1048697957 8:137049782-137049804 GCTGCTGGAGCTGCTGGAGCTGG - Intergenic
1048867056 8:138769002-138769024 GGGGCTGGAGAGACAGGAGATGG - Intronic
1048906396 8:139093279-139093301 GTTGCTGGAGGAACAGGATTTGG + Intergenic
1049146862 8:141006740-141006762 GCTGTTGTAGGGACAGTAGCAGG - Intergenic
1049168148 8:141139798-141139820 GCTGCTGGGAAGGCAGGAGCAGG - Intronic
1049288692 8:141790502-141790524 GCTGCTGGGGGGACAGGCTGAGG + Intergenic
1049571121 8:143370774-143370796 CCTGCGGGAGGGACGGCAGCTGG - Intronic
1049612509 8:143562068-143562090 GCTGCTGGAGGGCCTGGAGGGGG + Exonic
1049655334 8:143794636-143794658 GCAGCTGGAGGGGCGGGTGCTGG - Intronic
1049667439 8:143852525-143852547 GCATCTGGATGGACAGCAGCCGG - Intergenic
1049682910 8:143927688-143927710 GCTGCGGGGGGCACAGGAGGTGG - Exonic
1050090972 9:2016343-2016365 ACTGCTGGAGGGAAGGGAGGAGG + Intronic
1050130417 9:2406547-2406569 GTTACTGGGGGGCCAGGAGCAGG + Intergenic
1050413186 9:5387247-5387269 GCTGCTGGAGGGTTTGGATCAGG + Intronic
1050528006 9:6562987-6563009 TCTGCAGGAGGGAGAGGGGCTGG - Intronic
1050848568 9:10255997-10256019 GCTGCTGAACTGACAGGAGGTGG - Intronic
1051756457 9:20406140-20406162 GCTGCTGGGGGTACAGGAGAAGG - Intronic
1052205855 9:25839234-25839256 GGTGGAGGAGGGACAGGAGAGGG - Intergenic
1053001416 9:34578926-34578948 CCTTTAGGAGGGACAGGAGCAGG + Intronic
1053067353 9:35078074-35078096 GCAGCTGGAGAGAAAGGAGGAGG + Intronic
1053418349 9:37960971-37960993 GCTGCTGGTCTGGCAGGAGCTGG + Intronic
1054673700 9:67833010-67833032 GCGGCTGGAGGGATAGGAAGAGG + Intergenic
1055030691 9:71769163-71769185 GGTGCTGGAGGCACAGGCTCCGG - Intronic
1055429659 9:76230676-76230698 GCTGCTGATGTGACAGGAGATGG - Intronic
1056235062 9:84586298-84586320 GCTGCCTGAGGCACAGGAGTGGG - Intergenic
1057073149 9:92117907-92117929 GCTGCTGGAAGGAAAGCACCCGG - Intergenic
1057261335 9:93586486-93586508 GCTGGGGGAGGGCCAGCAGCCGG + Intronic
1057263542 9:93599386-93599408 CTTGCTGGAGCAACAGGAGCTGG - Intronic
1057581545 9:96291434-96291456 GCTGTGGGAGGGAGAGGAGGGGG - Intronic
1057605945 9:96497609-96497631 GCTGCTAACGGGAGAGGAGCGGG + Intronic
1057877199 9:98767242-98767264 GCTGAAGGAAGGACATGAGCAGG - Intronic
1059415131 9:114157489-114157511 GCTGGTGGAGGCACAGGAGAGGG - Intronic
1059484265 9:114614823-114614845 GCTGCTGGAGGGAGTGGCACTGG + Intronic
1059734340 9:117086653-117086675 GCTGGGTGAGGGACAGGAGGAGG - Intronic
1060110635 9:120904214-120904236 GCTGATGGAGGCACAGGATGTGG + Exonic
1060183253 9:121548064-121548086 GTTGCTGGAGGGACAGCATGGGG - Intergenic
1060962011 9:127687702-127687724 GCTACAGGAGGGAGAGGAGCTGG - Intronic
1060975282 9:127761627-127761649 GCTGCTGGAGAGCCAGAGGCTGG - Exonic
1061042917 9:128150073-128150095 ACTGGTGAAGGGGCAGGAGCAGG - Intronic
1061062455 9:128257498-128257520 GCTGCTGGAGCTGCAGGAGCTGG - Exonic
1061127834 9:128688274-128688296 GGTGCTGGAGGGACAGAATGTGG + Intronic
1061215485 9:129219314-129219336 TGTGCTGGAAGGTCAGGAGCTGG + Intergenic
1061434661 9:130553713-130553735 CCTCCTGGTGGGACAGGAGTGGG - Intergenic
1061582298 9:131545625-131545647 GGAGCTGGAGGGGCAGGTGCCGG + Intergenic
1061582303 9:131545640-131545662 GGTGCCGGAGGGGCAGGTGCTGG + Intergenic
1061582308 9:131545655-131545677 GGTGCTGGTGGGACAGGTACTGG + Intergenic
1061582336 9:131545745-131545767 GGTGCTGGCGGGGCAGGTGCTGG + Intergenic
1061582357 9:131545815-131545837 GCTGCTGGAGGGGCAGGTGCTGG + Intergenic
1061890461 9:133616615-133616637 GCTGCTGCTGGGACAGGCACAGG - Intergenic
1061925543 9:133804459-133804481 CCTGCTGGTGGGACAGGGCCAGG + Intronic
1061976631 9:134071359-134071381 GCTGCTGATCTGACAGGAGCCGG + Intergenic
1062150127 9:135013891-135013913 GCTCCTGGAGGGAAAGAAGTGGG - Intergenic
1062290834 9:135793659-135793681 GCTGCTGGAGGGGCCGGCCCTGG + Intergenic
1062397237 9:136357432-136357454 GGAGCAGGAGGGACGGGAGCTGG - Intronic
1062415188 9:136445395-136445417 GCTGTTGAAGGGAGAGGACCGGG + Intronic
1062460095 9:136659401-136659423 GCTGCAGGAGGTGCAGGAGGAGG - Exonic
1203779984 EBV:95941-95963 GGAGCGGGAGGGGCAGGAGCAGG + Intergenic
1203779989 EBV:95956-95978 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203779995 EBV:95974-95996 GCAGGAGGAGGGGCAGGAGCAGG + Intergenic
1203780013 EBV:96019-96041 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780019 EBV:96037-96059 GCAGGAGGAGGGGCAGGAGCAGG + Intergenic
1203780033 EBV:96073-96095 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780039 EBV:96091-96113 GCAGGAGGAGGGGCAGGAGCAGG + Intergenic
1203780049 EBV:96118-96140 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780063 EBV:96154-96176 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780069 EBV:96172-96194 GCAGGAGGAGGGGCAGGAGCAGG + Intergenic
1203780079 EBV:96199-96221 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780093 EBV:96235-96257 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780099 EBV:96253-96275 GCAGGAGGAGGGGCAGGAGCAGG + Intergenic
1203780112 EBV:96286-96308 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780117 EBV:96301-96323 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780131 EBV:96337-96359 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780136 EBV:96352-96374 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780141 EBV:96367-96389 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780146 EBV:96382-96404 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780155 EBV:96406-96428 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780164 EBV:96430-96452 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780173 EBV:96454-96476 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780183 EBV:96481-96503 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780193 EBV:96508-96530 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780202 EBV:96532-96554 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780211 EBV:96556-96578 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780220 EBV:96580-96602 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780226 EBV:96598-96620 GCAGGAGGAGGGGCAGGAGCAGG + Intergenic
1203780231 EBV:96613-96635 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203555931 Un_KI270743v1:208033-208055 GGTTCTAGAGGCACAGGAGCGGG - Intergenic
1185759347 X:2677926-2677948 GCTGCCGGGTGGCCAGGAGCAGG + Intergenic
1185932559 X:4219245-4219267 ACTGATGGAGTGCCAGGAGCTGG - Intergenic
1186191138 X:7068694-7068716 GTGCCTGGAGGGACAGGAGCAGG + Intronic
1186658244 X:11639816-11639838 GTTGGTGGGGGGTCAGGAGCAGG - Intronic
1187820301 X:23280258-23280280 GCGGGAGGAGGGAGAGGAGCAGG + Intergenic
1188002205 X:24993673-24993695 GCTGCGTCAGGGACAGGGGCTGG - Intronic
1188005367 X:25012959-25012981 CCAGCTGGAGGAACTGGAGCGGG - Exonic
1188356623 X:29199661-29199683 GCTGCTGATGTGACAGGAGGCGG + Intronic
1190084222 X:47381216-47381238 GCAGCAGGAGGAAGAGGAGCAGG + Intronic
1190299624 X:49049392-49049414 GCTGCTGCTGTGACAGAAGCTGG + Intergenic
1190337396 X:49270488-49270510 GGAGCGGGAGGAACAGGAGCAGG + Exonic
1190621423 X:52290296-52290318 CCTGCTTGAGTGCCAGGAGCAGG + Intergenic
1190733046 X:53236976-53236998 GCTCCTGGAAGGGCAGGAGCAGG + Intronic
1191672818 X:63764817-63764839 GCTGGGGGAGGGAGAGGATCAGG + Intronic
1195715532 X:107814590-107814612 GCTGGGGGAGGGACAGCATCAGG + Intergenic
1195802836 X:108733104-108733126 GCTGCTGCAGGAAGAAGAGCAGG - Exonic
1197976408 X:132170425-132170447 GGAGCTGGAGGAAGAGGAGCAGG - Intergenic
1198480221 X:137033922-137033944 GCTGCGGGCGCGGCAGGAGCGGG + Intergenic
1198934680 X:141894549-141894571 GTTGCTGTCGGGACAGGAGAAGG + Intronic
1199700196 X:150370146-150370168 AATGATGGAGGAACAGGAGCCGG + Intronic
1199711291 X:150471277-150471299 GCTGCTGCAGGTAGTGGAGCAGG - Exonic
1200000145 X:153056120-153056142 CGTGCGGGAGGGGCAGGAGCCGG + Intergenic
1200037627 X:153343675-153343697 GATGCTGGAGGGAAGAGAGCAGG - Intronic
1200062382 X:153489314-153489336 GCTGAAGGAGGGGCAGGTGCAGG - Intronic
1200183034 X:154162917-154162939 GCTGCCAGAGGGCCAGGAGATGG - Intergenic
1200188688 X:154200031-154200053 GCTGCCAGAGGGCCAGGAGATGG - Intergenic
1200194337 X:154237172-154237194 GCTGCCAGAGGGCCAGGAGATGG - Intergenic
1200200093 X:154274975-154274997 GCTGCCAGAGGGCCAGGAGATGG - Intronic
1201860304 Y:18590490-18590512 GCTTTTGGAGGGACCAGAGCAGG + Intergenic
1201867877 Y:18673788-18673810 GCTGCTGGAGGGCGAGGACGCGG - Intergenic
1201873019 Y:18729891-18729913 GCTTTTGGAGGGACCAGAGCAGG - Intergenic