ID: 901646284

View in Genome Browser
Species Human (GRCh38)
Location 1:10718487-10718509
Sequence TGCCCTCCTTGGGGAGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 1, 2: 1, 3: 47, 4: 335}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901646284_901646293 14 Left 901646284 1:10718487-10718509 CCACCTGCTCCCCAAGGAGGGCA 0: 1
1: 1
2: 1
3: 47
4: 335
Right 901646293 1:10718524-10718546 TCCAAGAACCCCAAATTGGAAGG 0: 1
1: 0
2: 2
3: 12
4: 150
901646284_901646296 22 Left 901646284 1:10718487-10718509 CCACCTGCTCCCCAAGGAGGGCA 0: 1
1: 1
2: 1
3: 47
4: 335
Right 901646296 1:10718532-10718554 CCCCAAATTGGAAGGCCACTAGG 0: 1
1: 0
2: 0
3: 5
4: 102
901646284_901646292 10 Left 901646284 1:10718487-10718509 CCACCTGCTCCCCAAGGAGGGCA 0: 1
1: 1
2: 1
3: 47
4: 335
Right 901646292 1:10718520-10718542 CTTCTCCAAGAACCCCAAATTGG 0: 1
1: 0
2: 2
3: 21
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901646284 Original CRISPR TGCCCTCCTTGGGGAGCAGG TGG (reversed) Intronic