ID: 901646284

View in Genome Browser
Species Human (GRCh38)
Location 1:10718487-10718509
Sequence TGCCCTCCTTGGGGAGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 1, 2: 1, 3: 47, 4: 335}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901646284_901646292 10 Left 901646284 1:10718487-10718509 CCACCTGCTCCCCAAGGAGGGCA 0: 1
1: 1
2: 1
3: 47
4: 335
Right 901646292 1:10718520-10718542 CTTCTCCAAGAACCCCAAATTGG 0: 1
1: 0
2: 2
3: 21
4: 187
901646284_901646296 22 Left 901646284 1:10718487-10718509 CCACCTGCTCCCCAAGGAGGGCA 0: 1
1: 1
2: 1
3: 47
4: 335
Right 901646296 1:10718532-10718554 CCCCAAATTGGAAGGCCACTAGG 0: 1
1: 0
2: 0
3: 5
4: 102
901646284_901646293 14 Left 901646284 1:10718487-10718509 CCACCTGCTCCCCAAGGAGGGCA 0: 1
1: 1
2: 1
3: 47
4: 335
Right 901646293 1:10718524-10718546 TCCAAGAACCCCAAATTGGAAGG 0: 1
1: 0
2: 2
3: 12
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901646284 Original CRISPR TGCCCTCCTTGGGGAGCAGG TGG (reversed) Intronic
900970465 1:5989877-5989899 TGCCCTCCTAGTACAGCAGGGGG - Intronic
901221676 1:7587035-7587057 TCCCCTTCTGGGGGAGCTGGTGG - Intronic
901646284 1:10718487-10718509 TGCCCTCCTTGGGGAGCAGGTGG - Intronic
901957683 1:12798150-12798172 GGCCCTCCTTGGTCAGAAGGTGG - Intergenic
902488641 1:16764612-16764634 CGGCCTCTTTGGGGAGCAGGAGG - Intronic
902671226 1:17975395-17975417 TGTCCTCTTTGGGAGGCAGGAGG - Intergenic
903285816 1:22276026-22276048 TGCCTTCCTTGGGGCCTAGGTGG - Intergenic
904300382 1:29550049-29550071 TAGCCTCCTTGGGGAACTGGGGG + Intergenic
904538431 1:31216594-31216616 TGCCCTGCTAGGAGAGCTGGAGG + Intronic
904821866 1:33250577-33250599 GGGCCTATTTGGGGAGCAGGGGG + Intergenic
905521767 1:38605793-38605815 GGCCTCCCTTGGGAAGCAGGGGG - Intergenic
905734270 1:40315286-40315308 TCCCCTCCTTGTGGGGTAGGAGG - Intronic
906195920 1:43930783-43930805 GGCCTTTCTTGGGGAGAAGGCGG + Exonic
906518024 1:46450926-46450948 TGCCCTGTCTGGGGAGCAGTGGG - Intergenic
907096927 1:51790592-51790614 TACCCACCTTGGGGAGGAGGTGG - Exonic
908673646 1:66576892-66576914 AGCTCTGCTTGGGGAGAAGGTGG - Intronic
910173025 1:84398621-84398643 TGGCCTCTTTGGGGTGCTGGGGG + Exonic
910354631 1:86340985-86341007 TGCCCACTTTGGGAAGCAGCAGG + Intergenic
912174861 1:107141919-107141941 TGCCGGCCTTGGGGATCTGGTGG + Intronic
912827971 1:112923732-112923754 TGCCCTCCTGGTGCAGCTGGTGG - Intronic
914705420 1:150166175-150166197 TGCCTTTCCTGGGCAGCAGGTGG - Intergenic
915347685 1:155206278-155206300 CACCCTGCTTGGGGGGCAGGCGG + Exonic
915731390 1:158056649-158056671 TCCCCTGCTTGGAGAGCAGGAGG + Intronic
917856597 1:179106135-179106157 AGCTCTCCTTGGGGAGGATGGGG + Exonic
917994502 1:180421169-180421191 TAAGCTCCTTGGGGAGTAGGGGG - Intronic
919270184 1:195331537-195331559 TGCCTTCCCTTGGGAGAAGGTGG - Intergenic
919987992 1:202689180-202689202 TCCCTTCCTTAGGGAGTAGGGGG - Intronic
920202234 1:204266590-204266612 TTCCCTCCTTGGGGTTCAGGTGG + Intronic
920345605 1:205303995-205304017 TGCCCTTCTTGGGGAGCAGGGGG + Exonic
920502571 1:206494491-206494513 TCCCCTCCTTGGGGTGCTGAGGG + Intronic
922481238 1:225941143-225941165 TGCTGCCCTGGGGGAGCAGGAGG + Exonic
922583761 1:226718557-226718579 TGCCCGGGTTGGGGTGCAGGGGG - Intronic
922605797 1:226889108-226889130 TGCCCTCCTTGTGCAGCACTGGG - Intronic
922947543 1:229529885-229529907 TGCCCTCTACTGGGAGCAGGTGG - Intronic
923531799 1:234817905-234817927 CGGCCTCTTTGGGGAGCAGGAGG + Intergenic
924235876 1:241999177-241999199 CCCCCTCCCTGGGCAGCAGGAGG + Intergenic
1063458523 10:6201619-6201641 CGCCCTCCCTGTGGAGCATGCGG + Intronic
1065140595 10:22714855-22714877 CTCCCTCCTTGGGGAGCGGCAGG - Intergenic
1065467980 10:26045701-26045723 TGGCCTGCTTGGGGAGCAAAAGG - Intronic
1065800191 10:29344802-29344824 TGCCCTCCTGGGGGAGGTGGGGG + Intergenic
1067098029 10:43315172-43315194 TGCGCACCTCCGGGAGCAGGCGG + Intergenic
1067942363 10:50667751-50667773 GGCCCAGCTTGGGAAGCAGGTGG - Intergenic
1069602633 10:69717792-69717814 AGCCATCCTGGGGGAGCTGGAGG - Intergenic
1070614786 10:77961400-77961422 GGGTCTCCATGGGGAGCAGGGGG - Intergenic
1070829523 10:79409917-79409939 TGCCCAGCTGGGGGAGGAGGCGG + Intronic
1071600920 10:86958384-86958406 TGCCCTCCATGGGCTGGAGGGGG - Intronic
1073073596 10:100809764-100809786 TGACCTCTCTGGGAAGCAGGAGG - Intronic
1074779551 10:116791249-116791271 TGACCTCCTTTGGGAGCAGTTGG - Intergenic
1075300853 10:121322906-121322928 TGCCTTCCTTAGGGAGAAGTAGG - Intergenic
1075472975 10:122707150-122707172 CGTCCTCCCTGGGGAGCTGGTGG + Intergenic
1075715262 10:124551777-124551799 TGCCGGCCTTGGGGAGCACCAGG + Intronic
1075782400 10:125026040-125026062 TGCCCTGCCTGGGGACCTGGGGG - Intronic
1076352418 10:129826145-129826167 AGCCCCTCCTGGGGAGCAGGTGG + Intergenic
1076557423 10:131336373-131336395 TGACCCACTTGGGAAGCAGGAGG - Intergenic
1076910350 10:133384909-133384931 TGCCATCCACTGGGAGCAGGAGG + Intronic
1077407459 11:2388997-2389019 TGTCCTCCTGGAGCAGCAGGGGG + Intronic
1077485460 11:2836435-2836457 TGCACTCCAAGGGGAGGAGGTGG + Intronic
1077557220 11:3231521-3231543 TTGCATCCTTGGTGAGCAGGAGG + Intronic
1079005629 11:16789610-16789632 TGCCCTCCTTGGTGGACAGTGGG + Intronic
1079135584 11:17774515-17774537 TGCACTCCCTGGGGGGCAGGGGG - Intronic
1081620919 11:44618786-44618808 TGATCTCCTTGGGGAGGTGGTGG + Intronic
1082750182 11:57006382-57006404 TGCCCTCTCTGTGGAGCAAGAGG + Intergenic
1083486854 11:62988512-62988534 TGCCCTCATGGGGGAGTGGGTGG + Intergenic
1083763517 11:64831493-64831515 TGCCATCCTCGGTGAGCTGGTGG - Exonic
1084641437 11:70428925-70428947 TTCCCTCCTTGGGGGTTAGGGGG + Intronic
1084709622 11:70835947-70835969 TGCCCTGCTCGGGGTGCAGTGGG - Intronic
1084784622 11:71435019-71435041 TGCCCACACTGGTGAGCAGGAGG - Exonic
1089146756 11:116335085-116335107 TTCCCTCCTAGGGGAGCACTTGG - Intergenic
1089189052 11:116641166-116641188 TGTCCTCCATGTGGGGCAGGAGG - Intergenic
1089243204 11:117098668-117098690 TGCCCCCCTCCGGGAGCTGGCGG + Intergenic
1089822635 11:121241833-121241855 TGCTCGCTTTGCGGAGCAGGAGG + Intergenic
1090418219 11:126555613-126555635 GGCCCTGCTTGAGGAGCAGCAGG + Intronic
1090462178 11:126901379-126901401 CTTCTTCCTTGGGGAGCAGGGGG + Intronic
1091285523 11:134406471-134406493 TCCCATCCTAGGGGAGGAGGTGG + Intronic
1091346310 11:134856667-134856689 TGACCACCTCGGGCAGCAGGAGG - Intergenic
1091346324 11:134856732-134856754 TGACCACCTCGGGCAGCAGGAGG - Intergenic
1092672752 12:10882413-10882435 GGCCTTCCTTGAGGAGGAGGGGG + Exonic
1092676942 12:10930862-10930884 GGCCTTCCTTGAGGAGGAGGGGG - Exonic
1094035135 12:26062132-26062154 TGTCCTCCTTCGGTAACAGGAGG - Intronic
1095708041 12:45258993-45259015 TGCCCTTCTTGGGGAAGGGGTGG + Intronic
1096786822 12:54021656-54021678 TGCCCTCCTTGAAGGGCGGGAGG - Intronic
1097246473 12:57610294-57610316 CGCCCTCCCTGGGCAGGAGGGGG + Exonic
1098301119 12:69055144-69055166 TGCTCTCCTGCAGGAGCAGGCGG + Intergenic
1100442997 12:94634697-94634719 TGCCCTACCTGGGGAGCAGTAGG - Intronic
1101029405 12:100644939-100644961 TGCCCTGCTTCGGGACCTGGTGG - Intergenic
1102011481 12:109621893-109621915 CGCCCACCTTGGGCAGCAGGTGG - Intergenic
1102111945 12:110371556-110371578 AGGCCTCCCTGGGGAGCTGGGGG - Intergenic
1102298829 12:111756886-111756908 TGGCCTCCCTGGTGAGCAGAGGG + Exonic
1102399626 12:112617156-112617178 TGCTTTCCTTAGGGAGCTGGAGG + Intronic
1103595899 12:122024024-122024046 TGCCCTCCCTGCAGAGCAGCTGG - Intronic
1104217407 12:126747724-126747746 TCCCCTCCATGGCCAGCAGGGGG - Intergenic
1104784064 12:131438536-131438558 TGCCCTAGTTGGGGAGGAGACGG + Intergenic
1104981719 12:132575954-132575976 TGCCCTCCCATGGGAGCAGAGGG - Intronic
1106804701 13:33294102-33294124 TCCCCTCTTTGTGGAGCAAGAGG - Intronic
1110371309 13:74743566-74743588 AGCCTTCCCTGGGGACCAGGGGG - Intergenic
1113572995 13:111372020-111372042 TGGCCACTTCGGGGAGCAGGAGG - Intergenic
1113879369 13:113615104-113615126 TCCCATCCTTGGGGAGCCTGTGG - Intronic
1114201857 14:20528628-20528650 TGCACTGCTTGGGGAGGAGGAGG - Intergenic
1115505792 14:34092995-34093017 TGCCCTCCTGGGGTAGCGGTAGG - Intronic
1118005605 14:61562160-61562182 TTCCCTCCCTGGAGAGGAGGTGG - Intronic
1119797686 14:77414009-77414031 TGGCCACCTTGGGAAGCAGCTGG - Exonic
1122074918 14:99229858-99229880 GGCCCTGCTTGCTGAGCAGGGGG - Intronic
1122143192 14:99674502-99674524 TGCCAACCTTGGGAACCAGGAGG + Intronic
1122299185 14:100722484-100722506 TCCCCTCCTTGGGTGGGAGGGGG - Intergenic
1122523017 14:102360087-102360109 TGCCCTTCTTGGTAATCAGGAGG + Intronic
1122577162 14:102749783-102749805 TGCCATCCTAGGGGAGCAGCGGG + Intergenic
1122812568 14:104296319-104296341 TGCCCTCCTGGGGAACCAGCAGG - Intergenic
1124873767 15:33570948-33570970 TGGGCTTTTTGGGGAGCAGGTGG + Intronic
1125381704 15:39092911-39092933 TGCCTACCCTGGGGAGCAGGAGG + Intergenic
1125679203 15:41520426-41520448 TGCCCTCTTTGGGGAACACGTGG - Exonic
1126618452 15:50611806-50611828 TACCCCACTTGGGGAGCCGGAGG + Intronic
1127861515 15:62997864-62997886 TGCCCTCCTGGGGGTGGGGGTGG - Intergenic
1130601902 15:85281248-85281270 GGCCCTCCTAGGAGAGGAGGCGG + Intergenic
1130767006 15:86880919-86880941 GGCCCTCCTAGGAGAGGAGGCGG - Intronic
1131747000 15:95459468-95459490 TGAACTCCTTTGGGGGCAGGAGG + Intergenic
1132885831 16:2181596-2181618 TGCCCTGAGTGGGGCGCAGGGGG + Exonic
1132896635 16:2232407-2232429 GGCCCTCCTGGGGGAACAGGAGG - Intronic
1133120296 16:3602386-3602408 TGCAGACCATGGGGAGCAGGTGG + Intronic
1135182766 16:20290019-20290041 TGGCCTCCTTGGGGAGTGCGGGG - Intergenic
1136116420 16:28097601-28097623 TTCCCACCCTGGGGGGCAGGGGG + Intergenic
1137553951 16:49458534-49458556 TGCCATCCTTGGGCAGCAGGTGG - Intergenic
1138516788 16:57540558-57540580 AGCCTTCCTGGAGGAGCAGGAGG + Intergenic
1139547401 16:67656138-67656160 TGCTCTCCTTGGGGAGGAAGGGG + Intronic
1139589547 16:67925994-67926016 TGCCCTCCAGGGGGTTCAGGAGG - Intronic
1140113263 16:72021296-72021318 TGCCCACCTTGGTCAGCAGGCGG - Exonic
1140450246 16:75064888-75064910 TGCACTGCTGAGGGAGCAGGAGG - Intronic
1140454014 16:75094063-75094085 CGCCCTCCTTGGGGAGGTGGGGG + Intronic
1140717931 16:77743616-77743638 TGCCCTCCCTGGGTGGGAGGTGG + Intergenic
1141204527 16:81923380-81923402 TCTTCTCATTGGGGAGCAGGAGG - Intronic
1141222161 16:82081152-82081174 TGCCCTCCTTGGAAGGCAAGAGG + Intronic
1141456499 16:84145568-84145590 CGCCCTCCCTGGGGGGCAGTCGG - Intronic
1141526523 16:84615315-84615337 TCCCATCCCTGGGGGGCAGGAGG + Intronic
1142205911 16:88783127-88783149 TGGCCTCCTTGGGGAGGATGGGG - Intronic
1143163160 17:4884571-4884593 TGCCCTCTTTAGGGAGCAGCAGG + Intronic
1143181504 17:4986988-4987010 CGCCCTCCTCGGGGAACAGATGG + Exonic
1143847257 17:9781890-9781912 TGCGGTCCTGGGGGACCAGGTGG - Intronic
1144766906 17:17738003-17738025 TGCCATCCCAGGGGGGCAGGTGG + Intronic
1144867347 17:18345106-18345128 TGGCCAGCTTGGGCAGCAGGAGG - Intronic
1145973298 17:28969692-28969714 TGCCCTCCTTGCTGGGGAGGGGG - Intronic
1146923194 17:36727446-36727468 TGCCCTGTGTGGGGAGCATGTGG + Intergenic
1146938345 17:36826300-36826322 TGCCATCCTGGGGCAGGAGGGGG + Intergenic
1147159125 17:38560418-38560440 TGCGCTCCCTGGGGAGGAAGGGG + Exonic
1147903919 17:43810416-43810438 TGCCCTGGTTGGGGAGGGGGAGG + Intronic
1148437669 17:47695636-47695658 GGCCTTCCTTGGGGAGGAGCTGG + Exonic
1148778758 17:50110169-50110191 CATCCTCCTGGGGGAGCAGGGGG + Exonic
1149088570 17:52750968-52750990 TGCCTGCTTTGTGGAGCAGGAGG - Intergenic
1150946708 17:69754483-69754505 AGCACTCCTTGGGGAGAAGGAGG - Intergenic
1151412911 17:73942955-73942977 TGCCCTCCATGAGGAGCATGGGG - Intergenic
1151451582 17:74201245-74201267 TGTCCCCCTTGGGGAGCTGGAGG + Intergenic
1152075768 17:78158748-78158770 AGCCCTGCTCGGGGAGAAGGGGG + Intronic
1152206280 17:78976336-78976358 TGGCCTCCTTGCGGGGTAGGGGG - Intronic
1152467313 17:80473687-80473709 TGGCATCCTTGGGGAGATGGGGG + Intronic
1152597571 17:81245501-81245523 TGCCCTCCTCGGCCAGCAGCAGG - Exonic
1152749769 17:82057257-82057279 TGCCCTCCCTGGGGCTGAGGAGG + Exonic
1152829849 17:82490565-82490587 GGCCCTGCTGGGGCAGCAGGTGG - Intergenic
1152835137 17:82524957-82524979 TGCCCTCTTTGAGGACAAGGTGG + Intronic
1153927017 18:9843191-9843213 TGCCCACAATGGGGTGCAGGAGG - Intronic
1154381283 18:13852147-13852169 TCCCCTCCTTCAGGAGCAGCTGG - Intergenic
1160158767 18:76455018-76455040 TGTCCTCTTTGGGGACCAAGGGG - Intronic
1160910906 19:1473440-1473462 TGCCCTCCCTTGGGACCAGGGGG - Exonic
1160989149 19:1853497-1853519 TGCCCTCCCTGGCCTGCAGGTGG - Exonic
1161222397 19:3123634-3123656 TGCCTCCCTGGGGGAGCCGGGGG - Exonic
1161469108 19:4447588-4447610 TCTCCTCCTCGGGGTGCAGGTGG + Exonic
1161469237 19:4448057-4448079 TGGCTTCCTTGGGGAACATGTGG - Intronic
1161628171 19:5338895-5338917 TGCTGTCCTTGGGGTGCAGAGGG - Intronic
1161975921 19:7607739-7607761 AGCCCACCTTGGGGGGGAGGGGG - Intronic
1162744900 19:12792713-12792735 CGGCCTCCTCCGGGAGCAGGTGG + Exonic
1162925999 19:13930756-13930778 TGGCTTCTTTGGGGTGCAGGAGG - Exonic
1163605903 19:18275103-18275125 TGGCTTCCTTGGGGAGCCGCTGG + Intergenic
1163641021 19:18462026-18462048 TGCCTGCCTTGGGCAGCAGGTGG - Intronic
1164433365 19:28207592-28207614 TGCCCCTCTTGGGGAGAAAGCGG - Intergenic
1165581875 19:36872410-36872432 TGCCCTCCCTGGGGGGCAGTGGG + Intronic
1167648339 19:50717555-50717577 TGCCGTCCCAGGGGAGCAAGGGG + Intronic
1168189246 19:54726037-54726059 TGACCACCTGGGGGAGAAGGAGG - Exonic
1168191255 19:54740254-54740276 TGACCACCTTGGGGAGAAGGAGG - Intronic
1168193518 19:54756858-54756880 TGACCACCTTGGGGAGAAGGAGG - Intronic
1168195581 19:54771596-54771618 TGACCACCGTGGGGAGAAGGAGG - Intronic
1168197482 19:54786447-54786469 TGACCACCTGGGGGAGAAGGAGG - Intronic
1168201405 19:54818299-54818321 TGACCACCTGGGGGAGAAGGAGG - Exonic
1168203957 19:54835826-54835848 TGACCACCTTGGGGTGAAGGAGG - Intronic
1168206140 19:54851982-54852004 TGACCACCTGGGGGAGAAGGAGG - Exonic
926131625 2:10306413-10306435 TGCTCTCCTATGGTAGCAGGGGG + Intronic
926684962 2:15691252-15691274 TGCCCTCCCTGGAGATCTGGAGG - Intronic
926801548 2:16664833-16664855 TGGGTTCCCTGGGGAGCAGGCGG + Intronic
927056154 2:19367315-19367337 TGCCTACCTAAGGGAGCAGGAGG - Intergenic
929877159 2:45806327-45806349 GTCCCTGCTTGGGGAGCGGGTGG - Intronic
931204957 2:60137905-60137927 TGCCCTCTGTGGGGAGAGGGAGG - Intergenic
932582314 2:72999915-72999937 TGCACTCCTTGGAGAGCTTGTGG - Intronic
933093279 2:78146690-78146712 GGCCCTCCCTGGCGTGCAGGTGG - Intergenic
934713220 2:96528825-96528847 TGAGCTCCTTGGGGAGCTGAGGG + Intergenic
934762414 2:96864004-96864026 TGCCCTTCTTCACGAGCAGGGGG + Exonic
937438443 2:121897739-121897761 TGCTCTCCTTGGCCAGCAGGTGG + Intergenic
938210045 2:129459563-129459585 TGCCTTCCCTGGGGACCTGGAGG + Intergenic
940227026 2:151410478-151410500 TGCCCTCCATGGGAGGCAGAAGG - Exonic
942315469 2:174693124-174693146 TGCCCTCTTTGGGGCTCAGCAGG + Intergenic
942507467 2:176658594-176658616 AGCCCAAATTGGGGAGCAGGTGG + Intergenic
943521071 2:188949708-188949730 TGACCCCCTTGGCGGGCAGGAGG - Intergenic
943524484 2:188999360-188999382 TTTCCTCCTTCGGGACCAGGGGG - Exonic
944432269 2:199646087-199646109 AGTCCTGCTTGGGGAGGAGGTGG - Intergenic
946196612 2:218035931-218035953 GGCCCTCCATGGGGAACATGGGG + Intronic
946404868 2:219486902-219486924 ACCCCTCCTTGGGGAGCAGTGGG + Intronic
946578346 2:221100750-221100772 TGCTCTCCTTGGTGAGCTGTTGG + Intergenic
947224721 2:227828795-227828817 TGTCCACCCTGGGGACCAGGGGG + Intergenic
947632573 2:231663551-231663573 TGGCCTCCCTAGGGAGCAGTGGG + Intergenic
948481690 2:238254324-238254346 TGGCCTCCCTGGGGAGTGGGAGG + Intronic
948545810 2:238727957-238727979 TGCCCTCCTTTGGAAGCATGAGG + Intergenic
948599375 2:239099720-239099742 CGCGCTCCTTGGGGAGAAGATGG - Intronic
948603219 2:239119296-239119318 TGCCCTGGATGAGGAGCAGGAGG + Intronic
948816481 2:240512888-240512910 CGCCCTTCCTGGGGAGGAGGGGG - Exonic
1168859597 20:1036629-1036651 ATCCCTCCATGGGGACCAGGGGG + Intergenic
1170849767 20:19994208-19994230 TGCCTTCCTTGGGAAGTAGGCGG + Intronic
1171495722 20:25553828-25553850 TGCCCAACTTGGGCAGCAGGAGG + Intronic
1171823427 20:29875204-29875226 TGCTCTCCTTCTGTAGCAGGAGG + Intergenic
1171896674 20:30815123-30815145 TGCTCTCCTTCTGTAGCAGGAGG - Intergenic
1172188101 20:33044089-33044111 TCTCCTCCATGGGGTGCAGGTGG - Intergenic
1172612635 20:36263031-36263053 TGCCCTCCTTGAGGACAACGAGG + Intronic
1172898363 20:38316370-38316392 TGCCAGCCTTGGGGACCAGTAGG + Intronic
1173660317 20:44728843-44728865 TGGTTGCCTTGGGGAGCAGGGGG - Intergenic
1173675944 20:44835806-44835828 GGCCCTTCCTGGGAAGCAGGTGG - Intergenic
1174569685 20:51492679-51492701 TCCAGCCCTTGGGGAGCAGGAGG + Intronic
1175222725 20:57426628-57426650 TGCCCTCCTGGGGGTGCTGTGGG - Intergenic
1175915663 20:62424624-62424646 AGCCCTCCATGGGGAGCCTGAGG + Intronic
1178899724 21:36589231-36589253 TGCTGTCCTTGGGGACCAAGGGG - Intergenic
1179580310 21:42339114-42339136 GGCCCTCCTGTGTGAGCAGGTGG + Intergenic
1179593111 21:42424254-42424276 TGCCCTCTGTGGCGGGCAGGGGG - Intronic
1179819928 21:43930756-43930778 TCCCCTCCTGGGGTGGCAGGAGG + Intronic
1180125630 21:45788308-45788330 TGTCACCCTCGGGGAGCAGGTGG + Intronic
1180230748 21:46425528-46425550 TGTCCCCCTCAGGGAGCAGGTGG + Intronic
1181335668 22:22125988-22126010 TGCCCACCTAGAGGAGTAGGAGG + Intergenic
1181575632 22:23792791-23792813 TGCTCTGCTAGGGGAGGAGGGGG - Intronic
1181584972 22:23848244-23848266 TGCATTCCTTGGGGCGGAGGGGG - Intergenic
1181684108 22:24516614-24516636 TGCCATGGGTGGGGAGCAGGGGG + Intronic
1181886123 22:26023659-26023681 TGCCCTCCTCAGGTGGCAGGCGG + Intronic
1182811777 22:33122937-33122959 TTGCTTCCTTGGGCAGCAGGGGG + Intergenic
1184345322 22:43909452-43909474 TCCCCTCCTTGGGGAAAAGATGG + Intergenic
1184380161 22:44140383-44140405 TGACCAGCTAGGGGAGCAGGAGG + Intronic
1184555643 22:45231535-45231557 GGCCCTCCCTGGGGAGGGGGTGG - Intronic
1184695185 22:46135039-46135061 GGAGCTACTTGGGGAGCAGGCGG + Intergenic
1184695374 22:46135931-46135953 TGCCCTCCATGGGGAAAAGTTGG + Intergenic
1185401836 22:50622970-50622992 CGCCCTCCTTGGAGAGAAAGAGG + Intronic
949283441 3:2373266-2373288 TGCACTCCTTGGGCAGGAGGAGG + Intronic
950032179 3:9860501-9860523 TGACCTCATTGGGGAGGAAGGGG - Intergenic
950469066 3:13173486-13173508 TGCCTTCCTCCAGGAGCAGGAGG - Intergenic
950958625 3:17081112-17081134 TCCCCTCTTTGTGGAGCAGGTGG + Intronic
951803419 3:26622412-26622434 TGCCCTCCTTGGGGGAAAAGCGG - Intergenic
951867209 3:27321669-27321691 TGCCCTCCTTTGGGACAAGCAGG + Intronic
953708272 3:45247504-45247526 TGCCCTGGTAGGGGAGCAGCTGG - Intergenic
953789897 3:45939301-45939323 TGTCCTCCTTTGGGAGCATTTGG - Intronic
954606787 3:51917163-51917185 TGCCCTCCTGAGGGAGAGGGAGG - Intergenic
954863956 3:53713132-53713154 TCCCCTCCTTGCAGAGCTGGGGG + Intronic
956458043 3:69443147-69443169 TCCCCTCCCTGGGGGTCAGGGGG - Intronic
959946665 3:112132736-112132758 TGACCTCCTTGTGGAGCATGAGG + Intronic
961624191 3:128248269-128248291 TGCCCTCCATGGGCAGAAGAAGG - Intronic
962434823 3:135356794-135356816 CTCCCTCCTTGGGCAGAAGGAGG - Intergenic
962955295 3:140260423-140260445 TACCCTCCTTTAGGAGCAGTTGG - Intronic
964306632 3:155347892-155347914 TGCCAGCCTGGGGGAGCAGTAGG - Intergenic
966318624 3:178676565-178676587 TGGCCTTCTTGGGAGGCAGGAGG - Intronic
966451910 3:180073000-180073022 TACCCTCCCAGGGGAGGAGGTGG + Intergenic
968541797 4:1171808-1171830 AGCCCTCCTGGTGGAGCAGGAGG + Intronic
968605141 4:1531910-1531932 TCCCCGCCCTGGGCAGCAGGAGG + Intergenic
968659318 4:1792682-1792704 TGTCCTCCTTGGGGGGCGGGGGG + Intergenic
969199598 4:5592326-5592348 TGCCCTCCTTGGAGAAAAGTGGG + Intronic
969455809 4:7299055-7299077 TGCCCAGCTGGGGGAGCTGGGGG - Intronic
969501765 4:7557789-7557811 TGCCTTCCTTGGGGAGGAAATGG + Intronic
969673810 4:8603960-8603982 AGGCCTCCTGGGGGAGCAGTGGG - Exonic
971363133 4:25954973-25954995 TGTCCCACTTGGGGAGTAGGGGG - Intergenic
972129454 4:35812529-35812551 TTCCCTCATTAGGAAGCAGGTGG - Intergenic
972927091 4:44022928-44022950 TGCTCTGCTTGGTGAGCAGATGG + Intergenic
977305452 4:95318353-95318375 TGCCCTCCTCGGGGAGCTCCAGG - Intronic
978173059 4:105697266-105697288 TGCCCTCCTTTTGGGGGAGGGGG - Intronic
978749546 4:112231759-112231781 TGGCCTCCTTCGGCAGCTGGAGG + Exonic
982897886 4:160957230-160957252 TCCCCACCTTTAGGAGCAGGTGG - Intergenic
983934869 4:173494630-173494652 TTTCCTCCTTGGGCACCAGGAGG + Intergenic
985703507 5:1387467-1387489 TGCCTGACTTGGGGAGCTGGGGG - Intergenic
987264025 5:16233420-16233442 TGCCATACTGGGAGAGCAGGTGG - Intergenic
989176132 5:38528292-38528314 TGACCTCCCAGGGGAGCAGGGGG + Intronic
989473226 5:41845154-41845176 TGCCGTGTTTGGGGAACAGGAGG - Intronic
990269159 5:54116144-54116166 AGCCATCCCTGGGGAGCAGGAGG + Intronic
990496596 5:56354197-56354219 TGACCTCCTGGAGGTGCAGGGGG - Intergenic
991499628 5:67264066-67264088 TGGCCTCCCTGGGAGGCAGGAGG - Intergenic
992293216 5:75302427-75302449 TGCCAGCCTAGGAGAGCAGGTGG - Intergenic
993413681 5:87600929-87600951 TCCACTCGTTGGGGGGCAGGGGG + Intergenic
993695880 5:91061106-91061128 TGCCCTCTTTTTGGAGCAAGAGG + Intronic
995494508 5:112726503-112726525 TTGTCTCCTTGTGGAGCAGGGGG + Intronic
995544730 5:113218444-113218466 TGCCCTCCTGGTTGAGCGGGCGG - Intronic
996110148 5:119555836-119555858 TGCCCACCTTAGGGAGCTAGAGG + Intronic
997210798 5:132075561-132075583 TGCACTCCTTGGGGAACACGTGG + Intronic
998975344 5:147639664-147639686 TGCCCTCCTACAGGAGCAGACGG - Exonic
999154746 5:149450294-149450316 GGGCCTGCTTGGGGAGGAGGTGG + Intergenic
999637896 5:153641496-153641518 TTCCCTCTTGGGGAAGCAGGAGG - Intronic
999726475 5:154442460-154442482 TGCCCTTCTTTGGGAACAGGTGG - Intergenic
1001426188 5:171624062-171624084 GGCCTCCCTTGGGCAGCAGGCGG + Intergenic
1001503142 5:172254917-172254939 TGGTCTCCTTGAGGAGGAGGAGG - Intronic
1001941317 5:175741755-175741777 TGCCTTGCAAGGGGAGCAGGAGG + Intergenic
1002690686 5:181047961-181047983 GGCCCTCGTCGGGGAGGAGGTGG + Exonic
1003972245 6:11310815-11310837 TGCTTTCTTTGTGGAGCAGGTGG - Intronic
1004427052 6:15513676-15513698 CTTCCTCCCTGGGGAGCAGGTGG + Intronic
1004727597 6:18326226-18326248 TGCACTCCTTGGGTGGCAGTGGG + Intergenic
1005221611 6:23594523-23594545 TGCCCTCATTGTGCAGCAGCAGG + Intergenic
1006075525 6:31529821-31529843 GGCCCTCCTTGAAGGGCAGGAGG + Exonic
1006489956 6:34378780-34378802 TGCCCTTCTTGGAGAGAGGGAGG - Intronic
1006516052 6:34546356-34546378 TGCCCTACTGGGACAGCAGGAGG + Intronic
1006990758 6:38212845-38212867 TGCGCTGCTGGGGGAGAAGGGGG - Intronic
1007228554 6:40331842-40331864 GGCCACTCTTGGGGAGCAGGAGG - Intergenic
1007697526 6:43743296-43743318 GGGCCTGCTTGGGTAGCAGGGGG - Intergenic
1007702477 6:43772978-43773000 TTTCCTCCTTGGGGCCCAGGAGG + Intronic
1010145275 6:72661414-72661436 TGCCTTCCTTGAGGTACAGGAGG + Intronic
1014963118 6:127711787-127711809 TGCTTTTCTTAGGGAGCAGGGGG + Intronic
1017212903 6:151876569-151876591 TTCCCTCCTTTGGTAGCAGCTGG - Intronic
1017686763 6:156921229-156921251 TGCCCTCCTTGGAAAGTTGGAGG + Intronic
1018129682 6:160717182-160717204 TTTCCACCTTGGGGAGCAGAGGG + Intronic
1018925857 6:168206545-168206567 TCTCCTGCTTGGAGAGCAGGGGG + Intergenic
1019124819 6:169831097-169831119 TGCCCACCCTCGGGAGGAGGAGG + Intergenic
1019316894 7:391056-391078 GGCCTTCCTTGGGGAGCGGGAGG + Intergenic
1019644115 7:2120039-2120061 AGCTCTCCCTGGGGACCAGGTGG + Intronic
1019692592 7:2424880-2424902 TGCCCCCGTGGAGGAGCAGGAGG + Intronic
1020080768 7:5284620-5284642 TGCCTTCCCTGGGGCGCAGTAGG + Intronic
1022258577 7:28682995-28683017 TGTCATCCTTGGGGAGAGGGTGG - Intronic
1023850383 7:44146695-44146717 TGACCTCAGTGGGGAGCAGTGGG - Intronic
1024098427 7:46005098-46005120 TTCACTCCTTGGGGAGAAGCAGG + Intergenic
1025041331 7:55648579-55648601 TGCTCTCCTAGGGCAGGAGGAGG - Intergenic
1030529375 7:110693957-110693979 TTCCCTTCTTGGGGAACAGAGGG + Intronic
1031811025 7:126369088-126369110 TGGACTGCTTGGGGGGCAGGTGG - Intergenic
1031973269 7:128078638-128078660 TGTCCTCCTTGGGGAGAGTGGGG - Intronic
1034964704 7:155383979-155384001 TGCCCCTCCTGGGAAGCAGGGGG - Intronic
1035333372 7:158110893-158110915 TTCCTTCCTCGGGGCGCAGGGGG + Exonic
1035471158 7:159109638-159109660 TGCCCGTCTTAGGGAGCAGAAGG - Intronic
1036424229 8:8628499-8628521 TGCCCTCCCTGGTGAGCCAGTGG + Intergenic
1039840439 8:41289156-41289178 GGCCTTGCCTGGGGAGCAGGAGG + Intronic
1040072115 8:43196724-43196746 CGCCCTCTCTGGGGAGGAGGAGG - Intronic
1040634527 8:49256566-49256588 TGCTCTCCTTGGCTAGCAGATGG + Intergenic
1044824513 8:96183591-96183613 TGTCCTGCCTGGGGAGGAGGTGG - Intergenic
1048280600 8:133102866-133102888 TGGCCTCGTCTGGGAGCAGGTGG + Intronic
1048330952 8:133470587-133470609 TGAGCTCCTTGGGAAGCACGGGG + Intronic
1049223180 8:141437051-141437073 TGCCCGCCGTGGGGAGCTGTGGG + Intergenic
1049223195 8:141437088-141437110 TGCCCGCCATGGGGAGCTGTGGG + Intergenic
1049223210 8:141437125-141437147 TGCCCGCCGTGGGGAGCTGTGGG + Intergenic
1049223225 8:141437162-141437184 TGCCCGCCGTGGGGAGCTGTGGG + Intergenic
1049223240 8:141437199-141437221 TGCCCGCCGTGGGGAGCTGTGGG + Intergenic
1049223255 8:141437236-141437258 TGCCCGCCGTGGGGAGCTGTGGG + Intergenic
1049223270 8:141437273-141437295 TGCCCGCCGTGGGGAGCTGTGGG + Intergenic
1049317152 8:141975411-141975433 TTGCCTCTTTGGGGAGGAGGAGG + Intergenic
1049573599 8:143380608-143380630 TGCCATCCTGGGGCAGGAGGAGG + Exonic
1051604740 9:18908255-18908277 TGGCAGCCTTGGGGAGCAAGTGG + Intronic
1051726215 9:20089865-20089887 TGCGCTTGTTGGGGAGCAGGGGG - Intergenic
1052067064 9:24034962-24034984 TGCCCTGGTTGGGAATCAGGTGG + Intergenic
1052611152 9:30774752-30774774 GGTTCTCTTTGGGGAGCAGGAGG + Intergenic
1053426361 9:38012729-38012751 TGCCCTCCGTGTGCCGCAGGTGG - Intronic
1053749303 9:41236443-41236465 TGCTCTCCTTCTGCAGCAGGAGG - Intergenic
1054254744 9:62801294-62801316 TGCTCTCCTTCTGCAGCAGGAGG - Intergenic
1055455203 9:76465645-76465667 TGGCCACCCTGGGGAGGAGGAGG + Intronic
1055514358 9:77020943-77020965 TGCACTCCTAGGGGACCCGGCGG + Exonic
1056082158 9:83106638-83106660 AGCCATCCTAGTGGAGCAGGTGG - Intergenic
1056937778 9:90930546-90930568 TTTCCTTCTTGGGAAGCAGGGGG + Intergenic
1057927746 9:99168136-99168158 AGCCCTCCTGGGGGAGGAGGGGG - Intergenic
1059423462 9:114206655-114206677 AGCCCTCATTTGGGAGCAGGAGG - Intronic
1060233212 9:121840925-121840947 TGGCCTCCACTGGGAGCAGGTGG + Intronic
1060348723 9:122838842-122838864 GGTACTCTTTGGGGAGCAGGAGG + Intergenic
1060563660 9:124569364-124569386 TGCCCTTCCTGGGGTGGAGGAGG - Intronic
1061600922 9:131669548-131669570 TGCCCTCGTTCAGGGGCAGGGGG - Intronic
1061744356 9:132728647-132728669 TGTCCTCCTTGGAGAGGTGGAGG + Intronic
1061909766 9:133716456-133716478 TGCACTCTCTGGGAAGCAGGAGG - Intronic
1062117668 9:134818045-134818067 TGCCCACCTGAGGGAGGAGGCGG + Intronic
1062210429 9:135360602-135360624 TGGCCTCCTGGGAGAGAAGGTGG + Intergenic
1062337758 9:136079907-136079929 AGCTTTCCTTGGGGAACAGGTGG - Intronic
1062473146 9:136714945-136714967 TGTCCTCGTTGAGGAGCTGGTGG + Intronic
1062567987 9:137171705-137171727 CGCCCTCCTTGTGGTGCTGGCGG - Exonic
1203376493 Un_KI270442v1:381719-381741 TGCTCTCCTTCTGTAGCAGGAGG + Intergenic
1185494646 X:545192-545214 TGTACCCTTTGGGGAGCAGGAGG - Intergenic
1185573099 X:1149550-1149572 TGCCCTCACTGGGGAGTGGGTGG - Intergenic
1185663838 X:1748512-1748534 AGCCCCCATTGGTGAGCAGGTGG + Intergenic
1185977569 X:4738629-4738651 TGCACCTCTTTGGGAGCAGGTGG + Intergenic
1186191990 X:7075551-7075573 TGCCCTCCCTGGAGATGAGGGGG - Intronic
1188005688 X:25014386-25014408 TGCCCTCATGGTGGAGCAGCGGG - Intronic
1189775293 X:44464904-44464926 GGCTCTGCTTGAGGAGCAGGAGG + Intergenic
1190275010 X:48893770-48893792 TGCCATCCTTAGGGGGCAGCTGG + Exonic
1191842655 X:65524117-65524139 TGCCAGCCTTGGGGATCAGCGGG - Exonic
1194128641 X:90051310-90051332 TGCTGTCCTTGGGTAGCAGGTGG + Intergenic
1194838935 X:98715060-98715082 TCCACTTGTTGGGGAGCAGGGGG + Intergenic
1195665841 X:107429480-107429502 GGTACTCTTTGGGGAGCAGGAGG + Intergenic
1196898393 X:120360052-120360074 TTCCTTCCTTTGGGAACAGGGGG + Intergenic
1197767770 X:130070094-130070116 AGCCCTTCTTGGGGAAGAGGGGG + Intronic
1199360153 X:146907719-146907741 TGCCTTCTCTGTGGAGCAGGAGG + Intergenic
1200149570 X:153944612-153944634 TGGCTTCCTAGAGGAGCAGGAGG - Exonic
1200236066 X:154468286-154468308 TGGCGTCTGTGGGGAGCAGGAGG - Exonic