ID: 901646293

View in Genome Browser
Species Human (GRCh38)
Location 1:10718524-10718546
Sequence TCCAAGAACCCCAAATTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901646280_901646293 23 Left 901646280 1:10718478-10718500 CCAGTCTGTCCACCTGCTCCCCA 0: 1
1: 0
2: 4
3: 66
4: 587
Right 901646293 1:10718524-10718546 TCCAAGAACCCCAAATTGGAAGG 0: 1
1: 0
2: 2
3: 12
4: 150
901646285_901646293 11 Left 901646285 1:10718490-10718512 CCTGCTCCCCAAGGAGGGCACGC 0: 1
1: 0
2: 3
3: 23
4: 192
Right 901646293 1:10718524-10718546 TCCAAGAACCCCAAATTGGAAGG 0: 1
1: 0
2: 2
3: 12
4: 150
901646284_901646293 14 Left 901646284 1:10718487-10718509 CCACCTGCTCCCCAAGGAGGGCA 0: 1
1: 1
2: 1
3: 47
4: 335
Right 901646293 1:10718524-10718546 TCCAAGAACCCCAAATTGGAAGG 0: 1
1: 0
2: 2
3: 12
4: 150
901646289_901646293 3 Left 901646289 1:10718498-10718520 CCAAGGAGGGCACGCCAGGCTCC 0: 1
1: 0
2: 1
3: 16
4: 215
Right 901646293 1:10718524-10718546 TCCAAGAACCCCAAATTGGAAGG 0: 1
1: 0
2: 2
3: 12
4: 150
901646287_901646293 5 Left 901646287 1:10718496-10718518 CCCCAAGGAGGGCACGCCAGGCT 0: 1
1: 0
2: 0
3: 20
4: 163
Right 901646293 1:10718524-10718546 TCCAAGAACCCCAAATTGGAAGG 0: 1
1: 0
2: 2
3: 12
4: 150
901646288_901646293 4 Left 901646288 1:10718497-10718519 CCCAAGGAGGGCACGCCAGGCTC 0: 1
1: 0
2: 4
3: 10
4: 129
Right 901646293 1:10718524-10718546 TCCAAGAACCCCAAATTGGAAGG 0: 1
1: 0
2: 2
3: 12
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901646293 Original CRISPR TCCAAGAACCCCAAATTGGA AGG Intronic