ID: 901646296

View in Genome Browser
Species Human (GRCh38)
Location 1:10718532-10718554
Sequence CCCCAAATTGGAAGGCCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 102}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901646289_901646296 11 Left 901646289 1:10718498-10718520 CCAAGGAGGGCACGCCAGGCTCC 0: 1
1: 0
2: 1
3: 16
4: 215
Right 901646296 1:10718532-10718554 CCCCAAATTGGAAGGCCACTAGG 0: 1
1: 0
2: 0
3: 5
4: 102
901646291_901646296 -10 Left 901646291 1:10718519-10718541 CCTTCTCCAAGAACCCCAAATTG 0: 1
1: 0
2: 0
3: 35
4: 281
Right 901646296 1:10718532-10718554 CCCCAAATTGGAAGGCCACTAGG 0: 1
1: 0
2: 0
3: 5
4: 102
901646288_901646296 12 Left 901646288 1:10718497-10718519 CCCAAGGAGGGCACGCCAGGCTC 0: 1
1: 0
2: 4
3: 10
4: 129
Right 901646296 1:10718532-10718554 CCCCAAATTGGAAGGCCACTAGG 0: 1
1: 0
2: 0
3: 5
4: 102
901646290_901646296 -3 Left 901646290 1:10718512-10718534 CCAGGCTCCTTCTCCAAGAACCC 0: 1
1: 0
2: 1
3: 27
4: 309
Right 901646296 1:10718532-10718554 CCCCAAATTGGAAGGCCACTAGG 0: 1
1: 0
2: 0
3: 5
4: 102
901646284_901646296 22 Left 901646284 1:10718487-10718509 CCACCTGCTCCCCAAGGAGGGCA 0: 1
1: 1
2: 1
3: 47
4: 335
Right 901646296 1:10718532-10718554 CCCCAAATTGGAAGGCCACTAGG 0: 1
1: 0
2: 0
3: 5
4: 102
901646287_901646296 13 Left 901646287 1:10718496-10718518 CCCCAAGGAGGGCACGCCAGGCT 0: 1
1: 0
2: 0
3: 20
4: 163
Right 901646296 1:10718532-10718554 CCCCAAATTGGAAGGCCACTAGG 0: 1
1: 0
2: 0
3: 5
4: 102
901646285_901646296 19 Left 901646285 1:10718490-10718512 CCTGCTCCCCAAGGAGGGCACGC 0: 1
1: 0
2: 3
3: 23
4: 192
Right 901646296 1:10718532-10718554 CCCCAAATTGGAAGGCCACTAGG 0: 1
1: 0
2: 0
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901646296 Original CRISPR CCCCAAATTGGAAGGCCACT AGG Intronic