ID: 901646806

View in Genome Browser
Species Human (GRCh38)
Location 1:10721151-10721173
Sequence ATTATCTTTCTGGCCAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 208}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901646803_901646806 -2 Left 901646803 1:10721130-10721152 CCTTGATTTATTTGCCTATTAAT 0: 1
1: 0
2: 4
3: 67
4: 619
Right 901646806 1:10721151-10721173 ATTATCTTTCTGGCCAAGCTTGG 0: 1
1: 0
2: 1
3: 22
4: 208
901646795_901646806 23 Left 901646795 1:10721105-10721127 CCCGGTGCCCAGGGTCCCCTTGG 0: 1
1: 0
2: 2
3: 41
4: 354
Right 901646806 1:10721151-10721173 ATTATCTTTCTGGCCAAGCTTGG 0: 1
1: 0
2: 1
3: 22
4: 208
901646799_901646806 15 Left 901646799 1:10721113-10721135 CCAGGGTCCCCTTGGCTCCTTGA 0: 1
1: 0
2: 5
3: 18
4: 249
Right 901646806 1:10721151-10721173 ATTATCTTTCTGGCCAAGCTTGG 0: 1
1: 0
2: 1
3: 22
4: 208
901646801_901646806 7 Left 901646801 1:10721121-10721143 CCCTTGGCTCCTTGATTTATTTG 0: 1
1: 0
2: 2
3: 18
4: 316
Right 901646806 1:10721151-10721173 ATTATCTTTCTGGCCAAGCTTGG 0: 1
1: 0
2: 1
3: 22
4: 208
901646800_901646806 8 Left 901646800 1:10721120-10721142 CCCCTTGGCTCCTTGATTTATTT 0: 1
1: 0
2: 1
3: 26
4: 358
Right 901646806 1:10721151-10721173 ATTATCTTTCTGGCCAAGCTTGG 0: 1
1: 0
2: 1
3: 22
4: 208
901646798_901646806 16 Left 901646798 1:10721112-10721134 CCCAGGGTCCCCTTGGCTCCTTG 0: 1
1: 0
2: 3
3: 37
4: 244
Right 901646806 1:10721151-10721173 ATTATCTTTCTGGCCAAGCTTGG 0: 1
1: 0
2: 1
3: 22
4: 208
901646802_901646806 6 Left 901646802 1:10721122-10721144 CCTTGGCTCCTTGATTTATTTGC 0: 1
1: 0
2: 0
3: 17
4: 229
Right 901646806 1:10721151-10721173 ATTATCTTTCTGGCCAAGCTTGG 0: 1
1: 0
2: 1
3: 22
4: 208
901646797_901646806 22 Left 901646797 1:10721106-10721128 CCGGTGCCCAGGGTCCCCTTGGC 0: 1
1: 0
2: 1
3: 25
4: 306
Right 901646806 1:10721151-10721173 ATTATCTTTCTGGCCAAGCTTGG 0: 1
1: 0
2: 1
3: 22
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901646806 Original CRISPR ATTATCTTTCTGGCCAAGCT TGG Intronic
901646806 1:10721151-10721173 ATTATCTTTCTGGCCAAGCTTGG + Intronic
902054952 1:13592838-13592860 ATCATCTTTTTGGCCAGGCGCGG - Intronic
902085936 1:13862364-13862386 ATTATCATTCTGCCCAGGCGTGG + Intergenic
902319978 1:15655326-15655348 AACTTCTTTCTGGCCAAGCATGG + Intronic
903781707 1:25824217-25824239 CTTCTCTTTTTGGCCAATCTGGG + Intronic
903819297 1:26089038-26089060 GTTATCTATCTGGCAAAGGTTGG - Intergenic
904801485 1:33096126-33096148 ATTTTATTTCTGGCCAGGCATGG - Intronic
905014459 1:34767808-34767830 TTTATTTTTCTGGCCATGATGGG - Intronic
905020451 1:34807493-34807515 ATAATCTTCTTGGCCAAGCATGG + Intronic
905718535 1:40175358-40175380 ATTCTCATTCTGGCCAGGCACGG + Intronic
907061604 1:51431735-51431757 TTTATATTTCTGGCCAGGCGCGG - Intronic
908384591 1:63628899-63628921 TTTATCTTTCCAGTCAAGCTTGG - Intronic
908545569 1:65159052-65159074 ATTATCTGTCTGGCTAAGTAAGG - Intronic
908757262 1:67480272-67480294 AATTTCTTGCTGGCCAAGCTCGG - Intergenic
912388718 1:109286563-109286585 AGTCTGTTTCTGGCCAAGCGTGG - Intergenic
912526040 1:110283392-110283414 ATTAGTTTTCTGGGTAAGCTTGG - Intergenic
913697165 1:121338245-121338267 ACTCTCTCTCTGGACAAGCTGGG - Intronic
914140392 1:144941806-144941828 ACTCTCTCTCTGGACAAGCTGGG + Intronic
914720756 1:150286862-150286884 GTCATCTTTCTGGCCAAGGTGGG - Exonic
915151266 1:153833847-153833869 AATATATTTCAGGCCAAGCATGG + Intronic
916494181 1:165329894-165329916 ACTATCTGTGTGGCCCAGCTGGG + Intronic
917429004 1:174946049-174946071 TTAATCTTTCTGGGCAAGCTAGG - Intronic
917619992 1:176785918-176785940 ATGATCGTCCTGGCCAAGCAAGG + Intronic
918250248 1:182696971-182696993 ATCATCTGTCTGGCTAAGCAAGG + Intergenic
919145777 1:193632891-193632913 AGTATTTTCCTGGCCAAGCTAGG - Intergenic
920484500 1:206356576-206356598 ACTCTCTCTCTGGACAAGCTGGG - Intronic
921508342 1:216002264-216002286 ATTATAATTTTGGCCAAGATTGG - Intronic
921600088 1:217097469-217097491 CTTAGCTTTCTGGCAAAGCCTGG - Intronic
922059463 1:222073962-222073984 ATCATCCTGATGGCCAAGCTGGG + Intergenic
923554264 1:234988119-234988141 ATTTTCTGTCAGGCCCAGCTAGG + Intergenic
924734698 1:246745541-246745563 ATGAACTTTCTGGAGAAGCTGGG + Intronic
1063943250 10:11152237-11152259 CTTTTCTTTCTGTCCAAACTTGG - Intronic
1064935044 10:20670109-20670131 ATTATCATTATGGCCAAAATAGG + Intergenic
1065683409 10:28260481-28260503 AGTATGTTTCTGGCCAGGCATGG + Intronic
1065807985 10:29412434-29412456 CTTATCTTTCTGGATAAGGTGGG + Intergenic
1067781415 10:49210008-49210030 ATGATGTTTCTGGCCAGGCATGG - Intergenic
1068401572 10:56534362-56534384 ATTTTCTTTTTGGCCACGGTAGG - Intergenic
1068809445 10:61239243-61239265 AATATTTTTCTGGACAAGCATGG - Intergenic
1070030050 10:72668207-72668229 ACTAACTTTTTGGCCAGGCTCGG - Intergenic
1071669923 10:87598776-87598798 ATGATCTGTCTAGCCAGGCTTGG - Intergenic
1073467687 10:103703913-103703935 ATAATCTGTCTGGCAGAGCTGGG - Intronic
1075992790 10:126852027-126852049 GTTATTTTTCTGGCCAGGTTTGG + Intergenic
1077864077 11:6208882-6208904 ATTAGCTTTCTGGCCAGGCGCGG + Intronic
1078347498 11:10563789-10563811 ACTGTCTCTCTGGCCAGGCTAGG - Intronic
1078530082 11:12130447-12130469 ATGATCCTTCTAGCCAAGGTGGG + Intronic
1079395582 11:20060292-20060314 ATTATGTTGGAGGCCAAGCTGGG - Intronic
1081921951 11:46786596-46786618 TTTATGTTTTTGACCAAGCTGGG - Intronic
1085565919 11:77513376-77513398 ATAGTCTTTCTGGCCAGGCATGG + Intergenic
1087407491 11:97747511-97747533 ATTAACTTTCTGGAGAAACTGGG + Intergenic
1088261086 11:107944673-107944695 ATTTTCTTTCTGGCCTGGCGCGG - Intronic
1088789972 11:113216060-113216082 ATAACCTTTCTGGTCTAGCTTGG - Intronic
1089002317 11:115062053-115062075 ATTCTCTTTGAGGTCAAGCTGGG - Intergenic
1089723947 11:120456701-120456723 ATTATTTTTCTGACCAGGCATGG + Intronic
1089877066 11:121734230-121734252 TTTATGTTTCTTGCCAAACTTGG + Intergenic
1092859259 12:12705838-12705860 ATTATCATACTGGCCAGGCTTGG - Intergenic
1095764633 12:45881212-45881234 AGTATCCTACTGGCCAAACTGGG + Intronic
1096740883 12:53693347-53693369 ATTATCATTCTGGCCAGGCATGG - Intergenic
1099685456 12:85881773-85881795 GTTACCTTTGTGGCCAAACTTGG + Intronic
1101965073 12:109276841-109276863 ATGCTCTTTTTGGCCAGGCTGGG + Intergenic
1102524515 12:113502076-113502098 TTGATCTTTCTGGGGAAGCTTGG - Intergenic
1104336414 12:127899875-127899897 ATTATCTTCCAGGGCCAGCTTGG - Intergenic
1107733825 13:43375152-43375174 ATTCTCTTTCTGGACAAGGTGGG - Intronic
1109875232 13:68394164-68394186 AGCATCTGTGTGGCCAAGCTTGG - Intergenic
1110195087 13:72780035-72780057 ATTATATTCCTGGCCAGGCACGG + Intronic
1111075280 13:83227604-83227626 ATTAACTCTCTGGCTAAGCAAGG - Intergenic
1112040506 13:95542462-95542484 ATTTTATTTCTGGCCAAACTGGG - Intronic
1115005660 14:28481309-28481331 AGTATACTTCTGGCCAAGCACGG + Intergenic
1115471982 14:33777342-33777364 ATAATATTTTTGGCCAAACTAGG - Intronic
1116633153 14:47359063-47359085 ATTATATTACTGGCCAGGCACGG + Intronic
1117687263 14:58266844-58266866 ATTTTCTTTATAGCCAAGTTAGG - Intronic
1117770537 14:59129910-59129932 ATTATGTGTCTGGCCAGGCACGG + Intergenic
1120543400 14:85779426-85779448 ATTATCTTTCTGATCAATGTAGG + Intergenic
1124078670 15:26470756-26470778 ATTATCTTTCTCTCCAGGGTTGG + Intergenic
1125417781 15:39471289-39471311 ATTTTTTTTCTGGTCAAGATGGG - Intergenic
1125451320 15:39810644-39810666 GTTATCTTTCTGTACAAGCATGG - Intronic
1127098842 15:55542638-55542660 ATTTTCTGTCTGGCCAGGCGTGG + Exonic
1128437324 15:67666518-67666540 ATGATCACTGTGGCCAAGCTTGG + Intronic
1130928500 15:88403130-88403152 TTAATCATTCTGGCCAAGTTAGG + Intergenic
1131864837 15:96696620-96696642 ATTATGTTTATGGCCAGGCGCGG - Intergenic
1134198206 16:12175430-12175452 TTCATCTTTTTGGCCAGGCTGGG - Intronic
1135379895 16:21987128-21987150 AAGATCATTCTGGCCAGGCTTGG + Intronic
1136240949 16:28943627-28943649 AATATCCTGCTGGCCAGGCTTGG + Intergenic
1136847127 16:33585600-33585622 ATTATCTAACTGGCCAGGCACGG - Intergenic
1137608033 16:49799961-49799983 TATATTTTTCTGGCCAAGCGTGG + Intronic
1138298979 16:55910723-55910745 TTTCTCTTTCTGGCAAAGCATGG + Intronic
1138312688 16:56041647-56041669 CTTATCTTTCTGGCCTTGTTGGG - Intergenic
1138480845 16:57302426-57302448 ATTATCCTTTTGGCCAGGCGAGG + Intergenic
1139205204 16:65022365-65022387 ATTATCTCTCTGACAAAACTGGG + Intronic
1203108835 16_KI270728v1_random:1434255-1434277 ATTATCTAACTGGCCAGGCACGG - Intergenic
1143655541 17:8291444-8291466 ACCATGTTTCTGGCCAATCTCGG + Exonic
1143879301 17:10017617-10017639 ATCATCGTTCTGGCCAGGCATGG - Intronic
1144508999 17:15859105-15859127 ATGGTTTTTTTGGCCAAGCTTGG - Intergenic
1148147180 17:45373351-45373373 ATAATCTTTCTGGTGATGCTGGG + Intergenic
1149726789 17:58903181-58903203 ATTGCTTTTCTGGTCAAGCTTGG + Intronic
1150177487 17:63075807-63075829 ATTTTCTTTCTGGCCAGGCGCGG - Intronic
1153477003 18:5508090-5508112 ATTGTCTTTCTGGCTAACCAAGG - Intronic
1155264718 18:24080096-24080118 ATTAAATTTCTAGCCAAGGTTGG - Intronic
1155325082 18:24657002-24657024 ATTTTCTTTCTGGCCATTCAGGG + Intergenic
1157632288 18:49110528-49110550 ATTATCTGACTTGCCTAGCTAGG + Intronic
1158252728 18:55507578-55507600 ATTATCTTTTTTGCCTACCTAGG + Intronic
1158678174 18:59541884-59541906 AAAATCTTTGTGGCCAAGCATGG + Intronic
1160920326 19:1516536-1516558 ATTATCTGTTTGGCCAAGCATGG - Intergenic
1162449671 19:10747318-10747340 ATTTCCTTTCTGGACAAGATGGG - Intronic
1162747848 19:12809062-12809084 ACCATCTTTCTGCCCAGGCTAGG - Intronic
1165033438 19:33015132-33015154 ATTATCTAACTGGCCAGGCACGG + Intronic
928150414 2:28823330-28823352 AATATGTTTCTGGCCAGGCACGG + Intronic
929977158 2:46646059-46646081 CTTATCTTTCTGGCCTATCCAGG + Intergenic
930397189 2:50837474-50837496 ATTTTCTTTCTTGCAAAACTGGG + Intronic
931034987 2:58230456-58230478 TGTATCTTTCTAGCCAGGCTTGG - Intronic
932074788 2:68652821-68652843 AGCAACTTTCTGGCAAAGCTGGG + Intronic
932136744 2:69237709-69237731 GTTATCTTTCTGGCCAGGTGAGG - Intronic
932391678 2:71396652-71396674 ATTATCTTTCAAGCCAGGCATGG + Intronic
932441909 2:71742898-71742920 AATAGATTTATGGCCAAGCTAGG + Intergenic
933148888 2:78890706-78890728 ATAATCTTTGTGGCCAAAATGGG - Intergenic
935010350 2:99129458-99129480 ATTACCTATCAGGCCCAGCTAGG + Intronic
936145731 2:109979632-109979654 ATTCTCCTTCTGGCCATGCTGGG + Intergenic
936198958 2:110391846-110391868 ATTCTCCTTCTGGCCATGCTGGG - Intergenic
937161451 2:119766203-119766225 ATTTTCTTTGTTGCCAAGTTGGG + Intronic
939053922 2:137339394-137339416 AATGTCTTTCTGGCCATTCTTGG + Intronic
942499085 2:176569412-176569434 ATTATCTCTCACACCAAGCTTGG - Intergenic
944870107 2:203901954-203901976 ATTAGCTTTCAGGCCATACTGGG + Intergenic
945800976 2:214430112-214430134 ATTTTCTTCCTGGCCAGGCACGG - Intronic
947933881 2:233986536-233986558 ATTTTCTTTCTGACCATGATGGG - Intronic
948331900 2:237175555-237175577 TATATCTTCTTGGCCAAGCTTGG + Intergenic
1168793581 20:596246-596268 AATATCTTCCAGGCCAAGCGCGG + Intergenic
1168868758 20:1111063-1111085 ATTATGTTTTTGGCCAGGCATGG + Intergenic
1169446283 20:5673772-5673794 ATTCTTTTCCTGGCCAAGCATGG - Intergenic
1169597995 20:7222773-7222795 TTTGTCTTTCTGGCCAAGTGCGG + Intergenic
1171131833 20:22661059-22661081 ATTATCTTTCTGGCAAATTTGGG - Intergenic
1173677698 20:44852092-44852114 ATTAATTTACTGGCCAAGCATGG + Intergenic
1174249364 20:49207042-49207064 ATTATTTTTTTGGCCAGGCGAGG - Intergenic
1178732105 21:35113851-35113873 ATTATCTTTCCAGCCAAATTGGG - Intronic
1178820498 21:35970904-35970926 AATGACTTTCTGGCCAGGCTTGG + Intronic
1179036751 21:37764666-37764688 AGTAAATTTCTGGCCAAGCTCGG - Intronic
1183865680 22:40702355-40702377 ATTCTCTTCCTGGCCAGACTTGG - Intergenic
1184357047 22:43989166-43989188 ATTACCTTTCCGGCCAGGCCAGG + Exonic
1184407017 22:44306065-44306087 AGTAGCTTTCTGACCTAGCTTGG - Intronic
950597798 3:14000151-14000173 ATGATGTTTCTGGCCAGGCTCGG - Intronic
951962621 3:28346461-28346483 AATACCTTTCTTGCCAAGTTTGG - Intronic
952164519 3:30732603-30732625 ACTTTCTTTCTGACCAAGCAGGG + Intronic
953183698 3:40619361-40619383 AGAATCTTTCTGGCCAAGTGTGG - Intergenic
953609863 3:44438584-44438606 ATTATTTTTTTGGCCAGGCACGG - Intergenic
954485322 3:50844930-50844952 ATTAACTTTCTGGCCAGGCACGG + Intronic
955311515 3:57892652-57892674 ACTTGCTTTCTGGCCAACCTTGG + Intronic
955608940 3:60737131-60737153 ATAATATTCCTGGCCAGGCTGGG - Intronic
956724122 3:72143141-72143163 ATTTTCTTTCTGACCAACATGGG + Intergenic
956771878 3:72533630-72533652 ATTGACTTTCTGGCCAATCCTGG - Intergenic
959720760 3:109485569-109485591 ATTATGTTTCTGACAAAACTGGG + Intergenic
960063018 3:113342699-113342721 ATTGGCTTTATGGCCAGGCTTGG + Intronic
960489783 3:118301655-118301677 ATTATCTTTCTCCCCAGTCTGGG + Intergenic
963500344 3:146117779-146117801 ATTATCTTTTCTGTCAAGCTGGG + Intronic
964345308 3:155749224-155749246 ATGAGCTTTCTGTACAAGCTGGG + Intergenic
965111414 3:164428703-164428725 ATTATATTTCTGGCCAGGCATGG - Intergenic
971138451 4:23897016-23897038 ATGAGCTTTCTGCCCAAGCACGG - Intronic
971428884 4:26542774-26542796 AGCATCGTTCTGGCCAAGTTAGG + Intergenic
972539942 4:40030515-40030537 TTTATCTTCCTGGCCAGGCGCGG + Intergenic
974572790 4:63675907-63675929 ATCATCTTTCTCACCAAGCCTGG - Intergenic
974663163 4:64921220-64921242 ATTTTATATCTGGCCAAACTAGG + Intergenic
976401201 4:84608886-84608908 ATTTTCTTTCTGGCCGGGCGTGG + Intronic
977941260 4:102862027-102862049 ATTATCTATATAGCCAAGGTGGG - Intronic
978222629 4:106294769-106294791 ATTATTTTCCTGGCCAGGCGTGG - Intronic
978239701 4:106500808-106500830 ATTTTCTTTTTGGCCAGGCACGG - Intergenic
978379723 4:108114314-108114336 TTTATCGTTTAGGCCAAGCTTGG - Intronic
978598464 4:110403311-110403333 ATTTTCTTTCTAGGTAAGCTAGG + Intronic
979460041 4:120971552-120971574 ATTTTCTTTAAGGTCAAGCTGGG - Intergenic
979573604 4:122259569-122259591 TTTAACTTTCTGGCCAGGCGCGG + Intronic
981646578 4:147005191-147005213 ATTTTCTTTTTGGCCAGGCGCGG - Intergenic
993128702 5:83868924-83868946 ATCATATTTATGGCCAAGCATGG + Intergenic
994465486 5:100123733-100123755 ATTATCTTTAAGGCCTATCTTGG - Intergenic
994689940 5:103005538-103005560 CTTATCTCTCTGGCCATGCAAGG - Intronic
998831852 5:146167972-146167994 ATTATCTTTCTGGCCAGGCGCGG - Intronic
1001155925 5:169272408-169272430 ATTACCTGTCTGGCCCAGGTAGG + Intronic
1001700237 5:173701450-173701472 ATTATCTCTCTGGCCAGCCTGGG - Intergenic
1001879801 5:175233475-175233497 CTTGTCCTTCTAGCCAAGCTGGG + Intergenic
1002005299 5:176228056-176228078 AATATTTTTCTGGCCAGGCGTGG - Intergenic
1002221075 5:177682569-177682591 AATATTTTTCTGGCCAGGCGTGG + Intergenic
1003419135 6:5940064-5940086 AAAATCTTACTGGCCAGGCTAGG + Intergenic
1005991111 6:30902784-30902806 AAAATCCTTCTGGCCAAGGTTGG + Intergenic
1008428482 6:51387047-51387069 AGTATCTTTCTGGGCAGGGTTGG + Intergenic
1009800133 6:68527154-68527176 ATTATTTTTCTGGCAATGCAGGG + Intergenic
1010213240 6:73379312-73379334 ATTATTTTTCAGGCCAGGCATGG - Intronic
1010578239 6:77560997-77561019 AATTTCTTTGTGGTCAAGCTAGG + Intergenic
1010615101 6:78002928-78002950 ATTATTTTACTGGTCAAGCATGG - Intergenic
1010621182 6:78077506-78077528 ATTGTCTTTTTGTGCAAGCTAGG + Intergenic
1011599503 6:89046828-89046850 ATTTTTTTTCAGGCCAAGCATGG - Intergenic
1012670988 6:102047457-102047479 ATTTTCTTCCTGGCCAGGTTCGG + Intronic
1013143868 6:107367978-107368000 ATTGTATTTCAGGCCAAGCGCGG + Intronic
1015696181 6:135982453-135982475 AGAATCTGTCTGGCCCAGCTTGG + Intronic
1021311511 7:19103624-19103646 ATTATCTTTCCGGCCGGGCACGG + Intronic
1022946299 7:35288005-35288027 TTCATCTTTCTGGCCAGGCTCGG - Intergenic
1023903287 7:44501742-44501764 CTTATTTTTCTGGCCAGGCATGG - Intergenic
1025080419 7:55977098-55977120 ATTTTTTTTTTGGCCAGGCTCGG + Intronic
1025271124 7:57518077-57518099 ATTCTCTCTCCTGCCAAGCTGGG + Intergenic
1027426119 7:78062830-78062852 ATCATCCTTCTGCCTAAGCTTGG + Intronic
1027691931 7:81358583-81358605 ATTATCTTTATTCCCAAGCAGGG - Intergenic
1027916481 7:84329908-84329930 ATTATTTTTCTGGCCAACTTAGG + Intronic
1028420576 7:90628245-90628267 ATCACCTTTCTGGCCAGGCACGG - Intronic
1029359201 7:100075962-100075984 CATATGTTTCTGGCCAAGCTTGG - Intronic
1030631552 7:111901011-111901033 ATTTTCTTTCTGACCAAAATAGG - Intronic
1032600799 7:133292052-133292074 ATTGTCTTTGTGGCCAGGCATGG + Intronic
1033576588 7:142691108-142691130 ATTATCTTTTTGGCCAGTCATGG + Intergenic
1033839265 7:145354153-145354175 ATTTACTTTCTGGCCAGGCGTGG + Intergenic
1038894689 8:31769369-31769391 ACTGTCTTTCTGGCCCAACTTGG - Intronic
1041335970 8:56784287-56784309 AGTTTCTTTCTGGCCAGGCGCGG + Intergenic
1043436932 8:80244237-80244259 ATCATCTTTCTGGGCAGGCGCGG - Intergenic
1043491420 8:80752829-80752851 ATTATTTTTTTGGCCAGGCGCGG - Intronic
1043862495 8:85336550-85336572 AGTATCGTTGTGGCCAAGCCAGG - Intronic
1045472104 8:102521676-102521698 ATACTCTTTCTGGCCAGGCGTGG + Intergenic
1047984639 8:130220078-130220100 ATTATCTTGCAGGCCAGGCGTGG - Intronic
1048098118 8:131316215-131316237 ATTAACTATCTGGCCAATCAAGG - Intergenic
1048744638 8:137600234-137600256 ATTATCCATCTGGCCAAATTTGG - Intergenic
1055325627 9:75125267-75125289 ATCATCTTTCTGGCCTCTCTGGG + Intronic
1055476164 9:76665741-76665763 ATTATCTTCCAGGCCAGGCGTGG + Intronic
1059491808 9:114674094-114674116 AAAATCTTTCTGGCCAGGCGCGG - Intergenic
1059636691 9:116178396-116178418 AATATCTTTCCGGCCAGGCAAGG - Intronic
1060085209 9:120693028-120693050 AGTATCTATCTAGCCCAGCTAGG + Intronic
1061955705 9:133960264-133960286 AAGAACTTTCTGGCCCAGCTTGG - Intronic
1187044520 X:15632927-15632949 ATTGTCTTTCTGGCTATTCTTGG - Intronic
1188833162 X:34925796-34925818 ATTACATTTCTGGCCAGGCACGG - Intergenic
1188853784 X:35166348-35166370 ATTATGTTTCTGGCACAGCCTGG - Intergenic
1189480648 X:41389924-41389946 ATGATCTTTGAAGCCAAGCTTGG + Intergenic
1191062147 X:56310254-56310276 TTTATGTTTCTTCCCAAGCTCGG + Intergenic
1192115368 X:68405510-68405532 ATTTTCTTTCTTCCCTAGCTTGG + Intronic
1192227303 X:69238235-69238257 ACTGTCTTTCTGGCAAGGCTTGG - Intergenic
1192582782 X:72298861-72298883 AATTTCTTTCTGTCTAAGCTGGG + Intronic
1193637902 X:83975676-83975698 ATTTTCTTTTAGCCCAAGCTGGG - Intergenic
1196302857 X:114066369-114066391 ATCATCATTCTTGCCCAGCTTGG - Intergenic
1197535638 X:127685652-127685674 AATATCTTCCTGGTCAATCTTGG + Intergenic
1198838993 X:140835931-140835953 ATTACCTTTCTAGGCCAGCTTGG + Intergenic
1198891337 X:141400645-141400667 ATTTTGTATCTGGCCAAACTAGG - Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic
1200323172 X:155211191-155211213 ATTAACTGTCTTGCCCAGCTAGG + Intronic