ID: 901651082

View in Genome Browser
Species Human (GRCh38)
Location 1:10743614-10743636
Sequence TTCTATAAAAATAAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 534}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901651076_901651082 8 Left 901651076 1:10743583-10743605 CCAGATGGATTCTTTTCCTGCCT 0: 1
1: 0
2: 1
3: 23
4: 246
Right 901651082 1:10743614-10743636 TTCTATAAAAATAAGGAGGGAGG 0: 1
1: 0
2: 1
3: 41
4: 534
901651077_901651082 -8 Left 901651077 1:10743599-10743621 CCTGCCTTTTTTTTTTTCTATAA 0: 1
1: 6
2: 114
3: 1089
4: 8317
Right 901651082 1:10743614-10743636 TTCTATAAAAATAAGGAGGGAGG 0: 1
1: 0
2: 1
3: 41
4: 534
901651074_901651082 28 Left 901651074 1:10743563-10743585 CCATTTCAATTATTCATATGCCA 0: 1
1: 0
2: 2
3: 24
4: 341
Right 901651082 1:10743614-10743636 TTCTATAAAAATAAGGAGGGAGG 0: 1
1: 0
2: 1
3: 41
4: 534

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901651082 Original CRISPR TTCTATAAAAATAAGGAGGG AGG Intronic
901042927 1:6376424-6376446 CTCTTTAAAAATAAGGTGGGAGG + Intronic
901264774 1:7902256-7902278 TTCCATACAAAAAAGCAGGGTGG - Intergenic
901651082 1:10743614-10743636 TTCTATAAAAATAAGGAGGGAGG + Intronic
903099397 1:21015068-21015090 GTTTAAAAAAAAAAGGAGGGGGG + Intronic
904198105 1:28801172-28801194 TTCTGTAAACTGAAGGAGGGTGG + Intergenic
905385579 1:37601479-37601501 TTCTTAAAGAAAAAGGAGGGAGG - Intergenic
905401687 1:37708301-37708323 TTCTAAAAAGAAAAGGAGAGAGG - Exonic
905842914 1:41200175-41200197 TTCTATAAAAATAATGCTTGTGG + Intronic
905998320 1:42401446-42401468 GTCTAAAAAAAAAAGGAAGGAGG + Intronic
906023159 1:42649151-42649173 TTCAAAAAAAATAAAGAGGAGGG + Intronic
907027430 1:51134954-51134976 TTCAAAAAAATTAAGGAGGAGGG + Intronic
907481191 1:54746573-54746595 TTTAATAAAAATAAAGAGGCAGG - Intergenic
907940543 1:59083209-59083231 TTAGAAAAAAAAAAGGAGGGTGG - Intergenic
908534343 1:65065290-65065312 TTCTATAAAGGGAAGGAGGGGGG - Intergenic
909092097 1:71238939-71238961 TTCTATAATTATTAGTAGGGAGG - Intergenic
909176436 1:72367632-72367654 TTCTGAAAAATTAAGGAGGAGGG - Intergenic
909637555 1:77833827-77833849 TTCTTTAAACAAAAGGGGGGAGG + Intronic
910494951 1:87816452-87816474 TTCTAGAAACATAAATAGGGTGG + Intergenic
910542484 1:88376294-88376316 TTATATAAAAAGAAAGAGGCAGG + Intergenic
910780665 1:90928617-90928639 TGTTTTAAAAATAAGGAGGCCGG - Intronic
910853874 1:91674621-91674643 TTCCATAAACATGGGGAGGGAGG + Intergenic
911511403 1:98810924-98810946 TTCCAAAAAATTAAGGAGGAGGG + Intergenic
912051117 1:105528673-105528695 TTCTAAAAAAAAAAAGGGGGGGG - Intergenic
912063497 1:105704995-105705017 TTCTATAAAAATAAGAAAGTAGG - Intergenic
912601437 1:110938165-110938187 TTCTGAAAAAATGAGGAGGAAGG + Intergenic
913525052 1:119683320-119683342 TTCTATTAAAACAATGAGGCTGG + Intronic
914565513 1:148862173-148862195 TGCTATAAAAAAAAGGAAAGTGG - Intronic
914607312 1:149268076-149268098 TGCTATAAAAAAAAGGAAAGTGG + Intergenic
915194710 1:154180920-154180942 ATCTAAAAAAAAAAAGAGGGGGG + Intronic
915463512 1:156082803-156082825 TTTTATGGAAATGAGGAGGGGGG + Intronic
915772596 1:158444121-158444143 TTCTGGAAAAATGAGGGGGGTGG - Intergenic
916487894 1:165275606-165275628 TGCTATAGAAATAAGGAAGGGGG - Intronic
916609355 1:166375477-166375499 TTCCAGAGAAAGAAGGAGGGGGG - Intergenic
916654140 1:166858574-166858596 TTCAAAACAAATAAAGAGGGAGG + Intronic
916665516 1:166963563-166963585 TTCTAGAAAAATATGGAGAGTGG - Intronic
916925653 1:169517792-169517814 AGCTCTTAAAATAAGGAGGGCGG + Intronic
917775961 1:178334702-178334724 TTCTAAAAAAATAGGCAGGCCGG + Intronic
917952362 1:180052475-180052497 TTCAATAAAAAAAAGGATGCAGG + Intronic
918087001 1:181254205-181254227 TTATATAAAAATAAAGGGAGAGG + Intergenic
918866879 1:189912307-189912329 TTCCAAAAAATTAAGGAGGAGGG - Intergenic
918979033 1:191530941-191530963 TGATATAAAAAAAGGGAGGGTGG + Intergenic
919086288 1:192924591-192924613 TTTTAAAAAAATAAAAAGGGGGG + Intergenic
919894286 1:201999241-201999263 TTTTCTAAAAATAAGGCCGGGGG + Intronic
920038506 1:203081260-203081282 TTCTGTGAAAATAACGAGTGAGG + Intergenic
920889668 1:209971920-209971942 TTCCAGAAAAACAAGGAGGAGGG - Intronic
920893062 1:210012461-210012483 ATCAATAAAAACAAGGAGTGTGG + Intronic
920951914 1:210580372-210580394 TTCTTTAAAAAAAAAAAGGGGGG + Intronic
921969261 1:221128051-221128073 GTCTACAAAAATAAGCAGTGGGG + Intergenic
924069951 1:240266365-240266387 TTCAATAAAAATAAGCAATGGGG - Intronic
1063045570 10:2388643-2388665 TACAAGAAAAATAAGAAGGGTGG - Intergenic
1063729893 10:8684679-8684701 ATTTTTAAAAATAAGGAGGAGGG + Intergenic
1064888792 10:20145004-20145026 TTCTTTAAAAACAAGGACTGTGG + Intronic
1065224654 10:23531444-23531466 TTCTAAAAAAAGGTGGAGGGAGG - Intergenic
1065371598 10:24992330-24992352 TTTTAGATAAATAAGGAGGTCGG + Intronic
1065499991 10:26370729-26370751 TTCCAAAAAAATGAGGAGGAGGG - Intergenic
1065543327 10:26792622-26792644 TTTTATAAAAATAAGTAGATTGG + Intronic
1067535054 10:47102964-47102986 TGCCATCAAAATAAGGAGGAAGG + Intergenic
1068907239 10:62340398-62340420 TTCTCTTATAATAGGGAGGGGGG - Intergenic
1069233970 10:66047085-66047107 TTCTATAAAATGGAGGAGGAGGG + Intronic
1071039578 10:81290288-81290310 TTCCATAAAACTGAGGAGGAGGG + Intergenic
1072239744 10:93484463-93484485 TACCATAAAAATCAGGAGAGTGG - Intergenic
1073362058 10:102907686-102907708 TACTATAAAAGTAAGGATAGTGG + Intergenic
1074620923 10:115120950-115120972 TTCTGTAAAAATAAGAATAGTGG + Intronic
1075816595 10:125269463-125269485 TTCTTTAAAAAGAGGGAGAGAGG + Intergenic
1076639565 10:131904979-131905001 TTTTAAAAAAAAAAGGGGGGTGG - Intronic
1077732562 11:4748400-4748422 TTCCAAAAAATCAAGGAGGGGGG + Intronic
1077953237 11:6985006-6985028 TTCCAAAAAATTGAGGAGGGGGG + Intergenic
1079231799 11:18655542-18655564 TTCTTTTAAAAAAGGGAGGGGGG - Intergenic
1079441756 11:20522173-20522195 TTGTATAAAAATAATGACAGTGG + Intergenic
1079813250 11:25022734-25022756 TTCTATTAAAATAAGATGAGAGG + Intronic
1081010058 11:37799826-37799848 TTCTCAAAAAATGAGGAGGAGGG + Intergenic
1081509306 11:43752893-43752915 TTTTATAAAAATAAAAAGGTTGG - Intronic
1081844770 11:46232154-46232176 TGCTAAAAAAAAAAGGTGGGGGG + Intergenic
1082638290 11:55623580-55623602 TTCTACAAAAATAAGCAATGGGG - Intergenic
1082886110 11:58084397-58084419 TTCTAAAAAATTGAGGAGGAGGG + Intronic
1083020946 11:59506414-59506436 TTATCTAAAAATAAGGAGTATGG - Intergenic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1085193504 11:74650277-74650299 TTCTAACAAAGTGAGGAGGGAGG + Intronic
1086380077 11:86243803-86243825 ATCTGTAAAAATGAGGAGGCAGG - Intergenic
1086478793 11:87210621-87210643 TTCAAGAAAATCAAGGAGGGGGG + Intronic
1086912308 11:92487253-92487275 TTCTATCAAACCAAGGAGGTTGG + Intronic
1087687190 11:101278395-101278417 TTCTGTAAAAATAAAGAAAGAGG - Intergenic
1088058915 11:105620784-105620806 TTCTATAAAAATATGTAGACTGG - Intronic
1088388658 11:109289542-109289564 TTCCAAAAAAATAAAGAGGAAGG + Intergenic
1088739962 11:112759090-112759112 GTCACTAAATATAAGGAGGGAGG + Intergenic
1089099921 11:115954014-115954036 TTAAAAAAAAAAAAGGAGGGGGG + Intergenic
1089528779 11:119113363-119113385 TGCTATGAAAATATGGAGCGGGG - Intronic
1090145576 11:124318745-124318767 TTCTATAAAAATGGAGAGAGTGG - Intergenic
1091912929 12:4246226-4246248 TTCAAAAAAAAAAAGGAAGGGGG + Intergenic
1092626331 12:10333431-10333453 TTCTATTAATATAAGAAGGCAGG - Intergenic
1093452247 12:19329371-19329393 TTCCAAAAAAATAAGGAGGAGGG - Intronic
1093594249 12:20942691-20942713 TTCAAAAAAAAAAAGGGGGGGGG - Intergenic
1094651134 12:32376863-32376885 ATCTAAAAAAAAAAGGGGGGGGG + Intronic
1095613274 12:44157574-44157596 TTTTAAAAAAATAATGAGGTCGG + Intronic
1097317713 12:58189778-58189800 TTCTTTAAAAATAAGCAATGAGG - Intergenic
1098250364 12:68562835-68562857 TTCCAGAAAAAAAGGGAGGGGGG + Intergenic
1098911464 12:76213497-76213519 TGCTATAAAAATGAGCAGAGTGG - Intergenic
1099169236 12:79344098-79344120 TTTTATAAAGACAAGGAAGGTGG + Intronic
1099559227 12:84151471-84151493 TTCTAAAAAATTGAGGAGGAGGG - Intergenic
1099638307 12:85246871-85246893 TTATATAATAATAAGGAGTGTGG + Intronic
1099849286 12:88071925-88071947 TTCTGTAACAATAACGAAGGAGG + Exonic
1100723571 12:97385196-97385218 TTCTAGAACCATAAGGAAGGTGG - Intergenic
1100742538 12:97609357-97609379 TTTTAAGAAAATAAGGAGGGTGG - Intergenic
1100942174 12:99735717-99735739 TTCCAAAAAAATAAAGAGGAGGG + Intronic
1101036452 12:100711811-100711833 TTCTTTAAAAATGAAGAGGTAGG - Intergenic
1101110701 12:101482771-101482793 TTCTATATAAATAATGAAGCAGG - Exonic
1102641983 12:114374863-114374885 ATCAATAAAAAGAAGGAGGGAGG + Intronic
1104420293 12:128629360-128629382 TTTTTTAAAAATGAGGCGGGAGG + Intronic
1104436324 12:128759781-128759803 ATGTATAAAAATAAGGATGATGG - Intergenic
1104825356 12:131704173-131704195 TTCTAAAAACATCAAGAGGGTGG + Intergenic
1105396373 13:20040122-20040144 TTCCAAAAAATTGAGGAGGGGGG - Intronic
1105838686 13:24234052-24234074 CTCATTAAAAATAAGGGGGGAGG + Intronic
1107268670 13:38588567-38588589 TTCTCTTAAAGTAAGGTGGGTGG + Intergenic
1107294077 13:38891335-38891357 TTCTATTAAAATAACCAGAGTGG + Intergenic
1107465832 13:40649349-40649371 TTCTCTAAAAAAATGGGGGGTGG + Intronic
1107512237 13:41096370-41096392 CTCAAAAAAAAAAAGGAGGGGGG - Intergenic
1108255618 13:48607505-48607527 TTCTAAAAAACAAAGGAGAGAGG - Intergenic
1108682719 13:52793158-52793180 ATCTCAAAAAAAAAGGAGGGGGG + Intergenic
1109155499 13:58904659-58904681 TTCTAAAAAATTAAAGAGGAGGG - Intergenic
1109621016 13:64905300-64905322 TTCAATAAAAATAATCAGTGGGG + Intergenic
1109830133 13:67774988-67775010 TTCTATAAAAATAATGTGGTTGG + Intergenic
1109974311 13:69811077-69811099 TTCCAAAAAATCAAGGAGGGGGG + Intronic
1110294215 13:73843174-73843196 TTTTATAAAAACAAGTATGGAGG - Intronic
1110448497 13:75615812-75615834 TTCACTAAAAAGAAGGAAGGAGG - Intergenic
1110497149 13:76181472-76181494 TTCCAAAAAATTAAGGAGGACGG - Intergenic
1110556688 13:76868088-76868110 TTGTGTAAAAATAATGTGGGGGG + Intergenic
1110873838 13:80485298-80485320 CTCTAAATAAATAAGGAGAGGGG + Intergenic
1111080239 13:83296294-83296316 TTCTAAAGAATTAAGGAGGAAGG - Intergenic
1111092788 13:83469184-83469206 TTCTATACAATTAAGAAGGTAGG + Intergenic
1111444083 13:88322455-88322477 TTATATAAAAAGAAGAAAGGAGG + Intergenic
1111596164 13:90414256-90414278 TTGCATAGAAATAGGGAGGGAGG - Intergenic
1111792849 13:92880545-92880567 ATCTTTAAAAATAACGAGGTGGG + Intergenic
1111815450 13:93147391-93147413 TTCTTTTAAAAAAAGAAGGGAGG - Intergenic
1112254070 13:97812684-97812706 TTCTAAAAAATTGAGGAGGAGGG + Intergenic
1112640978 13:101274921-101274943 TTCCATGAAGCTAAGGAGGGTGG + Intronic
1112778638 13:102872723-102872745 CTCTTTAAAACTAAGGAGAGGGG - Intronic
1113664574 13:112132269-112132291 TTTTTTAAAAACAAGGAAGGAGG - Intergenic
1114185194 14:20395948-20395970 TTCTAGAAAGCAAAGGAGGGAGG + Exonic
1115184841 14:30674641-30674663 CTCAAAAAAAAGAAGGAGGGAGG + Intronic
1115297513 14:31845841-31845863 TTGGAGAAAAATAAGAAGGGAGG - Intronic
1115800610 14:36989398-36989420 TTCTTTAAATATTGGGAGGGGGG + Intronic
1116077957 14:40136087-40136109 TTCCACAAAAATGAGGAGGAAGG - Intergenic
1116334166 14:43635910-43635932 ATATATAAAAATAAGAAGAGAGG + Intergenic
1116449339 14:45047694-45047716 GTCTATAAAATTAGGAAGGGTGG + Intronic
1116607357 14:47018156-47018178 TTCTTTAAAAAAAAGAACGGGGG - Intronic
1117178190 14:53166671-53166693 TTCCTTAAAAAAAAGGTGGGGGG - Intergenic
1117359167 14:54956326-54956348 ATCTGTAAAAACAAGGAGAGGGG + Intronic
1118022673 14:61734757-61734779 TTCTATGAGATTAGGGAGGGGGG + Intronic
1118407270 14:65438060-65438082 TTTTATAATAATATGGAGAGAGG + Intronic
1118581746 14:67307304-67307326 TACTATAATAATATGTAGGGAGG + Intronic
1119154841 14:72400416-72400438 ATCTATAAAAATCAGGAGGTGGG - Intronic
1121793637 14:96718017-96718039 TTCTTTTAAAATGAAGAGGGAGG - Intergenic
1121916260 14:97839156-97839178 TTGTATGAAAATAAGGCAGGCGG - Intergenic
1202831824 14_GL000009v2_random:42821-42843 ATCTATACAAAGAAGGTGGGTGG - Intergenic
1124087776 15:26567890-26567912 TTATAGAAGAATTAGGAGGGGGG + Intronic
1126737715 15:51748836-51748858 TTCTATAAAGAAGAAGAGGGTGG + Intronic
1126864814 15:52925151-52925173 TTCTATAAAATAAATGAGGAAGG - Intergenic
1127385657 15:58464630-58464652 TTCTAGAAAAACAAGGAGCCCGG - Intronic
1127454463 15:59144461-59144483 ATCTCTAAAAATAAAGAGGCCGG - Intronic
1127939364 15:63678366-63678388 CTATATAAAAGTAAAGAGGGTGG + Intronic
1128552969 15:68609991-68610013 TTTTATCAAGAGAAGGAGGGTGG - Intronic
1128900639 15:71418705-71418727 TTCTAAAAAAATAAAGGAGGAGG - Intronic
1129786891 15:78315677-78315699 TTCTAAAAAAATAAAAAAGGAGG + Intergenic
1130037651 15:80376390-80376412 CTATATATAAATTAGGAGGGTGG - Exonic
1130680768 15:85994473-85994495 TTTTAAAAAAAAAAGGAAGGTGG - Intergenic
1130877775 15:88029137-88029159 CTATACAAAAATAATGAGGGGGG + Intronic
1136131430 16:28224313-28224335 TTCTAAAAAAAGAAAGAGGTAGG + Intergenic
1136664556 16:31797997-31798019 TTCCAAAAAATTGAGGAGGGAGG - Intergenic
1136729661 16:32397793-32397815 TTCTGAAAAAATGAGGAGGAAGG - Intergenic
1137533793 16:49301722-49301744 TTTTTTAAAAAAAAGGATGGAGG + Intergenic
1137822598 16:51460259-51460281 ATCTTGAAAAAAAAGGAGGGGGG - Intergenic
1138468643 16:57213333-57213355 TGCTTTAAGAATAAGGAGCGAGG + Intronic
1140279571 16:73542378-73542400 TTGTATAAAAATAAGGACGTTGG - Intergenic
1202996735 16_KI270728v1_random:119501-119523 TTCTGAAAAAATGAGGAGGAAGG + Intergenic
1203023422 16_KI270728v1_random:431843-431865 TTCTGAAAAAATGAGGAGGAAGG + Intergenic
1143096092 17:4479241-4479263 TGCTACAGAAAGAAGGAGGGAGG - Intronic
1143643155 17:8211093-8211115 TTTTATAAAAAGAAGAAGGCCGG - Intergenic
1143935458 17:10479789-10479811 TTCCAAAAAAGAAAGGAGGGAGG + Intergenic
1144964934 17:19070853-19070875 TTCTATAAAGAGATGGGGGGGGG + Intergenic
1144983033 17:19181325-19181347 TTCTATAAAGAGATGGGGGGGGG - Intergenic
1144985191 17:19196914-19196936 TTCTATAAAGAGATGGGGGGGGG + Intergenic
1145054122 17:19687992-19688014 TTCAAAAAAATAAAGGAGGGAGG + Intronic
1145932347 17:28694996-28695018 GTCTCAAAAAAAAAGGAGGGGGG + Intronic
1146064699 17:29625035-29625057 CTCTTTAAAGAGAAGGAGGGTGG - Intergenic
1146070565 17:29677253-29677275 TTCTAAAAACATTAGGAGGTAGG + Intronic
1146517342 17:33499489-33499511 ATCTATAAAGCCAAGGAGGGAGG + Intronic
1148826338 17:50397090-50397112 TTCTTTAAAAAGAAGCGGGGTGG - Intronic
1149068786 17:52514485-52514507 TTCCAAAAAACTAAGGAGGAAGG - Intergenic
1149247758 17:54731305-54731327 TTCCAAAAAATTAAGGAGGAGGG + Intergenic
1149815623 17:59721043-59721065 TGATATAAAAATAGGGATGGGGG + Intronic
1150045521 17:61909408-61909430 ATCTATAAAAATAAGAAGTAAGG - Intronic
1150142529 17:62742318-62742340 TAATAGAAAAATAAGGAAGGAGG - Intronic
1150714781 17:67562628-67562650 TTAGATACAAATAAGGTGGGTGG - Intronic
1153462160 18:5347806-5347828 TTCCAAAAAAATGAGGAGGAGGG + Intergenic
1153678316 18:7476048-7476070 TTCTAGAAAATGATGGAGGGAGG - Intergenic
1154058978 18:11040909-11040931 TTCTAGAAAAATTAGGAATGAGG + Intronic
1154104401 18:11507724-11507746 TTCAATAAAATTAAAGAGGGAGG + Intergenic
1154464294 18:14629282-14629304 TTCCAGAAGAAGAAGGAGGGAGG - Intergenic
1155230073 18:23764238-23764260 TAATATAAAAGTATGGAGGGGGG - Intronic
1155601014 18:27547708-27547730 TAATATAAAAATAAGGAAGCAGG + Intergenic
1156146414 18:34186450-34186472 TTTTATACATATAAGGAAGGAGG - Intronic
1156704957 18:39869532-39869554 GTCTATAAAAAGAGGGAGAGAGG + Intergenic
1157788846 18:50511764-50511786 TACTATAAAAATGTGGATGGCGG - Intergenic
1158144251 18:54293331-54293353 TTCTATAAATAAAAGAATGGCGG - Intronic
1158208934 18:55024381-55024403 TTCTGTAATAATAAGGAAGCTGG - Intergenic
1158719269 18:59909648-59909670 TTCTTTAAAAATATTGTGGGAGG + Intergenic
1160959148 19:1710323-1710345 TTCAATAAAACTGAGGTGGGGGG + Intergenic
1162882651 19:13671541-13671563 TTCTAGAAAAATAAGGTGGCCGG - Intergenic
1163317362 19:16550243-16550265 TTCTATAAAATGAAGGAGCTGGG + Exonic
1163606122 19:18276463-18276485 TTATTTAAAAATTAGTAGGGCGG + Intergenic
1163723996 19:18912145-18912167 CTCTAAAAAAATAAGAATGGGGG - Intronic
1165568133 19:36750432-36750454 CTCTATAAATGTAAGGAGTGTGG - Exonic
1168149478 19:54437191-54437213 TTCTAGAGAAATTAGGAGGGTGG + Intergenic
1168480217 19:56713759-56713781 TTCCATAATAAAAAGCAGGGAGG - Intergenic
1202640867 1_KI270706v1_random:84931-84953 ATCTATACAAAGAAGGTGGGTGG + Intergenic
925192083 2:1892899-1892921 TTCTAGAAAAAAAAGGATGTTGG - Intronic
925232224 2:2243655-2243677 TTCTATAAATAAAAGCAGTGTGG - Intronic
925556812 2:5140096-5140118 TTCTAAAATAATAAAGAGGAAGG - Intergenic
926055948 2:9774118-9774140 TCCTATAAAAATAAGGACACTGG + Intergenic
926581809 2:14638133-14638155 ATCAAATAAAATAAGGAGGGGGG + Exonic
926582458 2:14646083-14646105 TTCTATAAGAAAAAGGTGGAGGG - Intronic
926585243 2:14678815-14678837 TTCTACAAAAATAGGGGGTGGGG - Intergenic
926718061 2:15940406-15940428 TTTTATGGAAATCAGGAGGGCGG + Intergenic
928369324 2:30729367-30729389 TTGTTTAAAAATAGGAAGGGTGG + Intronic
929485802 2:42353098-42353120 TTAAAGAAAAAGAAGGAGGGTGG + Intronic
930975440 2:57453629-57453651 TTTTATGAAAATTACGAGGGAGG + Intergenic
931842735 2:66171378-66171400 TTTTATTCAAATAAGGAGGAAGG + Intergenic
932371730 2:71195256-71195278 TTCTAAAAAATTGAGGAGGAGGG - Intronic
933325208 2:80827057-80827079 TTCAATGAAACTAAGGTGGGTGG - Intergenic
933571360 2:84017109-84017131 TACTAGAAAAATCAGGAGAGTGG - Intergenic
934078373 2:88447403-88447425 TTCTATAAAAATCAGAATGCTGG + Exonic
934496430 2:94804919-94804941 ATCTATACAAAGAAGGTGGGTGG + Intergenic
936409843 2:112248027-112248049 TTTTATAAAACTAAGGAGGCTGG + Intronic
936604979 2:113942718-113942740 TTTTACACAAATAGGGAGGGGGG - Intronic
936911983 2:117602819-117602841 TTCTATAAATATATGGATGATGG + Intergenic
937144266 2:119628913-119628935 TTATTCAAAAATAATGAGGGGGG - Intronic
938043986 2:128100028-128100050 CTCAAAAAAAATAAGTAGGGTGG - Intronic
938917154 2:135953696-135953718 TGCTCTAAAAATAAGGGGGAGGG - Intronic
938937087 2:136136625-136136647 TTACAAAAAAAAAAGGAGGGTGG - Intergenic
940208501 2:151231669-151231691 TTCTAAAAAATTGAGGAGGAGGG + Intergenic
940528497 2:154847732-154847754 TTCTTTTAAAATCAGCAGGGTGG + Intronic
940607287 2:155942063-155942085 TTCCAAAAAATTAAGGAGGGAGG + Intergenic
940770211 2:157831463-157831485 TCCAATCAAAATAATGAGGGTGG + Intronic
941241561 2:163045023-163045045 TTCTTTAAAAAAAAGGTGGGGGG + Intergenic
941278798 2:163524409-163524431 TTCCAAAAAATTAAGGAGGAGGG - Intergenic
941287363 2:163630662-163630684 TTGTACAAAAAAAAGGGGGGGGG + Intronic
941381697 2:164801052-164801074 CTCTGGGAAAATAAGGAGGGAGG + Intronic
941571042 2:167171194-167171216 ATCTATTAAAATAAAGAGGGCGG - Intronic
942086773 2:172451170-172451192 TTAAATAAAAATAGGGAAGGAGG + Intronic
942636028 2:178006810-178006832 TTCTGTCAAAACAAGGGGGGGGG + Intronic
943276966 2:185879912-185879934 TTCCATAAAATTGAGGAGGAGGG + Intergenic
943659968 2:190548895-190548917 TATTATAAAAATCAGGATGGTGG - Intergenic
944560465 2:200931447-200931469 TGCTTTAAAAAAAAGGAGGAGGG + Exonic
944601854 2:201311251-201311273 TTCCAAAAAAATGAGGAGGAGGG + Intronic
944759110 2:202795005-202795027 TAATAAAAAAAAAAGGAGGGGGG + Intronic
944955663 2:204805518-204805540 TTCTAAAAAATAAAGGAGGAGGG + Intronic
945135190 2:206619510-206619532 TCCTAAAAAAAAAAGGGGGGGGG - Exonic
945368392 2:208985248-208985270 TTCTTTTGAAATAAGGAGGTTGG + Intergenic
945441391 2:209884316-209884338 GTCTATAATAATAAAGAGGAAGG + Intronic
945560162 2:211329973-211329995 TTCAATAAAAATAATGACGCAGG + Intergenic
945608085 2:211961965-211961987 TTCTATACAAGTAAGAATGGTGG + Intronic
945639169 2:212400445-212400467 TTCTATAAAAATAAAGATATGGG - Intronic
946000493 2:216478113-216478135 TCCCATAAGAACAAGGAGGGTGG + Intronic
947692825 2:232155225-232155247 CTTTAGAAAATTAAGGAGGGGGG - Intronic
947737173 2:232461679-232461701 CTCAAAAAAAAGAAGGAGGGAGG + Intergenic
947737202 2:232461927-232461949 TTTTTTAAAAATAAGGAGGGAGG + Intergenic
948812518 2:240489796-240489818 TTCCAAAAAATTAAGGAGGAGGG - Intronic
1169833009 20:9845874-9845896 TTCAAGAAGAATAAGGTGGGAGG + Intergenic
1169959341 20:11141615-11141637 TTCTTTTAAAATAAGGATGCTGG - Intergenic
1169988967 20:11477723-11477745 TTCAATCAAAAGAAGTAGGGTGG + Intergenic
1170301922 20:14893730-14893752 TTATAAATAAATAAGAAGGGTGG - Intronic
1171000687 20:21412836-21412858 CTGTCTAAAAAAAAGGAGGGAGG - Intergenic
1171239570 20:23554065-23554087 TTACAAAAAAAAAAGGAGGGGGG - Intergenic
1172083654 20:32361341-32361363 CTCTAAAAAAATAATGAGGCTGG + Intronic
1177165176 21:17593960-17593982 TTCTATAAAAATAAGTTTGATGG + Exonic
1178301482 21:31457095-31457117 TTCTAAAAAAATGATCAGGGAGG - Intronic
1178495582 21:33083281-33083303 TTATATAAAAATGTTGAGGGGGG - Intergenic
1178575569 21:33785987-33786009 GTCTGTAAAAACAGGGAGGGTGG + Intronic
1180361085 22:11896931-11896953 ATCTATACAAAGAAGGTGGGTGG - Intergenic
1181523541 22:23464159-23464181 TTCCATAAAATTAATGAAGGGGG + Intergenic
1181847753 22:25725946-25725968 CTCAAAAAAAAAAAGGAGGGGGG + Exonic
1182819064 22:33198599-33198621 TACTATAAAAGTTTGGAGGGTGG - Intronic
1184765914 22:46572466-46572488 TTCTCTAAAAATGATGAGGTTGG + Intergenic
1184966765 22:47980774-47980796 TAGCATAAAAGTAAGGAGGGAGG - Intergenic
949237541 3:1828251-1828273 GTCCATATAAATAAGGAGGATGG - Intergenic
949309697 3:2683085-2683107 TGCTATAAAAATAATGGTGGTGG - Intronic
949774345 3:7614809-7614831 TGACATAAAAATAAGGAAGGGGG - Intronic
949828915 3:8192930-8192952 TTCTATAAAATAATGGAGGAGGG - Intergenic
950299072 3:11858983-11859005 TTCTAGAAGAATAAAGAGAGAGG - Intergenic
950824086 3:15797553-15797575 TTCTTTAAAAAAAAAAAGGGGGG + Intronic
952086190 3:29824415-29824437 TGCTATAACAATAAGCTGGGTGG - Intronic
952257476 3:31707891-31707913 TTCTAGAAAAATAAAGAGTGTGG + Intronic
952455466 3:33467773-33467795 GTCTCAAAAAAAAAGGAGGGGGG + Intergenic
952676581 3:36038056-36038078 TTCCAGAAAAATAAAGAGGAAGG - Intergenic
953776838 3:45826203-45826225 TATTAGAAAAATAAGGAGAGGGG + Exonic
954480224 3:50792943-50792965 TTCTAAAAAACTAAGGAGGAGGG - Intronic
954972188 3:54660673-54660695 TTCCATAAAAATATGAAGGGAGG + Intronic
955394340 3:58546912-58546934 TTCTAAAAAATCAAGGAGGAGGG - Intergenic
955775460 3:62427885-62427907 TTCTACACAAATAATGAGAGGGG + Intronic
955875153 3:63481196-63481218 TGCTACAAAGAGAAGGAGGGAGG + Intronic
956343047 3:68247873-68247895 TTCTATACAAATAAAGAGAAAGG - Intronic
956553943 3:70496544-70496566 TTTTTATAAAATAAGGAGGGAGG - Intergenic
956718017 3:72095357-72095379 TTCTAAAAAAAAAAGGGGGGGGG - Intergenic
956858191 3:73296523-73296545 TTTTATAAAAATAAGGGTGGCGG - Intergenic
956858409 3:73298578-73298600 TTGTATAAAAATCAGGACAGGGG - Intergenic
957548425 3:81670808-81670830 TTCAAGAAAAAATAGGAGGGAGG + Intronic
957832713 3:85544280-85544302 TTATATAAAAAAGAGGAGGCCGG + Intronic
957912093 3:86633022-86633044 ATCAATAAAAATAAGGTGGGGGG + Intergenic
958661500 3:97073345-97073367 TTATATAAAAATTAGGAAGGAGG - Intronic
958933488 3:100232419-100232441 TTCTATTAAAAAAAGTAGGAGGG + Intergenic
959021633 3:101193768-101193790 CTCTATAAAAGTAAGAAGTGGGG - Intergenic
959119024 3:102211114-102211136 TTTTATAAACAGAAGGAAGGTGG + Intronic
959747263 3:109791234-109791256 TTCTATAAAAGAATGGATGGGGG - Intergenic
960517480 3:118618156-118618178 TACTATAGAAAGGAGGAGGGAGG + Intergenic
961675981 3:128567038-128567060 TTCAATAAAAAAGAGGAGGAAGG + Intergenic
962001395 3:131301890-131301912 TTCCAAAAAATTAAGGAGGAGGG - Intronic
962684636 3:137835478-137835500 TGCAATAAAAAAAAGGGGGGTGG + Intergenic
963783599 3:149511047-149511069 CTCTACAAAAAGAAGGAGGCTGG - Intergenic
963971247 3:151431614-151431636 TTCTATAAGAATAAGGATTCTGG - Intronic
964934688 3:162068419-162068441 TTAAATAAAAAGAATGAGGGAGG + Intergenic
965036444 3:163445129-163445151 TTCTCTAAAAAAAAAGCGGGGGG - Intergenic
965036649 3:163448106-163448128 TTCCAAAAAATCAAGGAGGGGGG + Intergenic
965251183 3:166346513-166346535 TTCTAAAAAATCAAGGAGGAGGG + Intergenic
966853034 3:184176189-184176211 TGCAATAAAAATAAGGACTGGGG - Intronic
967119045 3:186366295-186366317 TTCTTAGAAAATAAGGAGGCTGG + Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967478993 3:189952963-189952985 TTCTACCAAAATAAAGAGAGGGG + Intergenic
967730593 3:192903340-192903362 GTCTATAAAACGGAGGAGGGAGG + Intronic
968252973 3:197239431-197239453 TTCCAAAAAATTAAGGAGGAGGG + Intronic
968283745 3:197496150-197496172 TCTTATAAAAGCAAGGAGGGCGG - Intergenic
1202737693 3_GL000221v1_random:22456-22478 ATCTATACAAAGAAGGTGGGTGG - Intergenic
970086831 4:12357622-12357644 TTCTATAAAAATTATAATGGAGG + Intergenic
970668748 4:18371082-18371104 TTCTAAAAAACTGAGGAGGAGGG + Intergenic
971141038 4:23924897-23924919 TTCTATAAAAGAAAGGAAAGTGG - Intergenic
971708239 4:30076567-30076589 TTCCATAAAACTGAGGAGGAGGG - Intergenic
971747105 4:30596654-30596676 TTGTAAAAAAATAAACAGGGTGG - Intergenic
971964336 4:33532649-33532671 TTTTTTAAAAACAAGGATGGGGG - Intergenic
972971911 4:44586856-44586878 TTCTAAAAAATTGAGGAGGAGGG + Intergenic
973331585 4:48914930-48914952 TTATATAAAGATATGGAGTGGGG - Intergenic
973384383 4:49495462-49495484 ATCTATACAAAGAAGGTGGGTGG + Intergenic
974008198 4:56581640-56581662 TTCTATGAAAAAAAGGAAGCTGG - Intronic
975355059 4:73392595-73392617 TGCTATAAGAAAAAGCAGGGGGG - Intergenic
975415093 4:74096730-74096752 CTCCTTAAAAATATGGAGGGGGG - Intergenic
975471993 4:74780653-74780675 ATCTATTAAAATAAGGATGACGG - Intronic
975543765 4:75540745-75540767 TTCAATAAAAATAAGGATACTGG + Intronic
975712673 4:77176150-77176172 ATCTTTAAAAATAAGGAAGTAGG - Intronic
976103270 4:81588433-81588455 TTTTTTAAAAATCAGGAGGCCGG - Intronic
976145953 4:82043276-82043298 TACTGTAGAGATAAGGAGGGCGG + Intronic
976401057 4:84607735-84607757 TTTTTTAAAAAAAAGGAGTGAGG + Intronic
976727086 4:88225312-88225334 ATTTATAAAAATAAGCAGGAAGG + Intronic
977050982 4:92128460-92128482 TTCTATAACAGTGGGGAGGGTGG - Intergenic
977948300 4:102939510-102939532 TTCCAAAAAAATGAGGAGGAAGG + Intronic
978737654 4:112102406-112102428 CTTTATAAAGATAAGGTGGGGGG + Intergenic
978771480 4:112460981-112461003 TTCCAAAAAATTAAGGAGGAGGG + Intergenic
978907660 4:114026899-114026921 GTCTAAAAAAATCAGTAGGGTGG - Intergenic
979085123 4:116398972-116398994 TTCTATAAAAATAAATTAGGAGG - Intergenic
979149934 4:117298653-117298675 TTCTATCAGAATAAGCAGGTGGG - Intergenic
979584194 4:122395384-122395406 TTCATTAAAAATAATGAGGCCGG + Intronic
980288191 4:130808272-130808294 TTCTACAGAAAGAAGGAGGGTGG + Intergenic
980653588 4:135752888-135752910 TTCAATAAAAATAAAGAGAATGG + Intergenic
980693943 4:136331460-136331482 TTCCAAAAATTTAAGGAGGGGGG + Intergenic
981498823 4:145424043-145424065 TTTTATAAAAATAAAGAAGTAGG - Intergenic
981758157 4:148163596-148163618 TACTTTCAAAAAAAGGAGGGTGG - Intronic
981819481 4:148869213-148869235 TGCTATAAAAATAAATAGGTAGG - Intergenic
982664002 4:158238917-158238939 TTATTCAAAAATAATGAGGGGGG + Intronic
983570485 4:169202657-169202679 TTCTGTAGAAATAGGGAGGCAGG - Intronic
984010490 4:174365500-174365522 TTCTAGAAAAAAAAGGAGTTTGG + Intergenic
985101672 4:186464226-186464248 GTCTTTAAGAAAAAGGAGGGGGG + Intronic
1202768234 4_GL000008v2_random:170786-170808 ATCTATACAAAGAAGGTGGGTGG + Intergenic
986577821 5:9230683-9230705 TTTTATAAAATGATGGAGGGTGG + Intronic
987712639 5:21521935-21521957 TTCTTCAAAATTAAGGAAGGGGG - Intergenic
988203760 5:28105589-28105611 TCCTTTAAAAATAAGGTGGAAGG + Intergenic
988301740 5:29438556-29438578 TTCTTCAAAATTAAGGAAGGGGG + Intergenic
988659901 5:33254046-33254068 TTTTATAAAAATAAAGATGCAGG - Intergenic
988973612 5:36493628-36493650 TGCTACAAAAATAAAGAGGAAGG - Intergenic
990045851 5:51430087-51430109 ATCTATACACATAAGTAGGGAGG - Intergenic
990153460 5:52847141-52847163 TTCTTAAAAAATAAGAAAGGAGG + Intronic
990590764 5:57261402-57261424 TTTTAAAAAAAAAAAGAGGGAGG + Intronic
990831153 5:59959587-59959609 GTCAACAAAAATAAGCAGGGGGG + Intronic
990840409 5:60073552-60073574 TTCCAAAAAATTAAGGAGGAGGG - Intronic
990967138 5:61461316-61461338 TTCTAAAAAATTATGGAGGGAGG - Intronic
991288771 5:65010364-65010386 TTCTTTAAAAATAAAAAGGCTGG + Intronic
991331406 5:65496755-65496777 TACTATAAAAATAAAAAGGCTGG + Intergenic
991552206 5:67851158-67851180 TTCTATAAAAATTAGCCAGGAGG + Intergenic
991613766 5:68475114-68475136 ATCTGTAAAAATAACGAGGTAGG - Intergenic
992508739 5:77412956-77412978 TCCTCTAAAAATTAGGAGGTAGG - Intronic
992656678 5:78917368-78917390 TTCAATAAAATTAAGTAGGTGGG - Intronic
993317286 5:86426966-86426988 TTATTTAAAAATTAGGTGGGAGG - Intergenic
993555395 5:89330480-89330502 TCCTATAAAAATGAGCAAGGTGG - Intergenic
993586686 5:89739492-89739514 CTCTAGAATAATAAGGCGGGGGG + Intergenic
993738178 5:91502688-91502710 TTCTAGTCAAATAATGAGGGGGG + Intergenic
993934157 5:93980528-93980550 TTCTAGAAAAAGAAAGAGTGAGG - Intronic
994009825 5:94888713-94888735 TACTATAAAAATCAGGGGGTTGG + Intronic
994271925 5:97787803-97787825 TTTTTTTAAAATAAGGAGGAAGG - Intergenic
994644057 5:102447402-102447424 TTCTAAAAAAATCAAGGGGGAGG - Intronic
994845514 5:104984129-104984151 GACTAAAAAAAAAAGGAGGGGGG - Intergenic
995127372 5:108591804-108591826 TTCGGTAAAAAGAAGGTGGGGGG + Intergenic
995151143 5:108846841-108846863 TTCTATAAATATAAAAAGGTGGG - Intronic
996209697 5:120792849-120792871 TTCTATAAAGAAAAGGATGTGGG + Intergenic
996231782 5:121072929-121072951 TTTTATAAAAATAAGGATTCAGG + Intergenic
996630712 5:125628949-125628971 ATCTATCACAATAAGGTGGGTGG + Intergenic
996945279 5:129059241-129059263 TTCTAAAAAATAAAGGAGGGGGG + Intergenic
997061976 5:130516976-130516998 TTCCAAAAAATCAAGGAGGGAGG - Intergenic
997332593 5:133076550-133076572 TTATCTAAAAAAAAAGAGGGAGG - Intronic
998276956 5:140764347-140764369 TTCTATGAATATAAGGAATGTGG + Intergenic
998490692 5:142543971-142543993 TTTTAAAAAAATAAGGAAAGAGG - Intergenic
999578520 5:153007973-153007995 TTCAATAAAAATGAGAAGGGAGG + Intergenic
999796978 5:154998020-154998042 AACGATAAAAACAAGGAGGGAGG - Intergenic
1000466933 5:161590923-161590945 TTCAAAAAAATTGAGGAGGGGGG - Intronic
1000545359 5:162593495-162593517 TTCTATAAATATATGGAGCATGG - Intergenic
1000921004 5:167137087-167137109 TTTTGTAAAAATAAGAAGAGAGG - Intergenic
1001042872 5:168349354-168349376 TTCTATAGTTATAAGGTGGGGGG - Intronic
1001466936 5:171975755-171975777 TCCTGCCAAAATAAGGAGGGAGG - Intronic
1001899579 5:175414821-175414843 TACTATGAAAAAAAGGAGGAAGG - Intergenic
1003014303 6:2455711-2455733 GTCTAGCAAAAGAAGGAGGGTGG - Intergenic
1003022889 6:2527377-2527399 TTGAAGAAAAATAAGGAGAGAGG - Intergenic
1003285762 6:4732659-4732681 TTTTTTAAAAAAAAAGAGGGGGG + Intronic
1005097090 6:22128849-22128871 TTCTAAAAAATTGAGGAGGAGGG - Intergenic
1006185062 6:32176859-32176881 TTCTAGAAAAATAAAAAGTGAGG + Exonic
1006954401 6:37854768-37854790 TTCTTAAAAAAAAAGGGGGGGGG - Intronic
1007430948 6:41776621-41776643 CTCTAAAAAAAAAAGGGGGGGGG + Intronic
1008199591 6:48569686-48569708 TTCTTTAAAAATAAGGTGAAGGG - Intergenic
1008789432 6:55212316-55212338 TTCTATAGAAATAAAAAAGGGGG - Intronic
1008857742 6:56112283-56112305 TTCAAAATAAATCAGGAGGGAGG + Intronic
1008991328 6:57605309-57605331 TTCCAAAAAACTGAGGAGGGGGG - Intronic
1009179853 6:60503537-60503559 TTCCAAAAAACTGAGGAGGGGGG - Intergenic
1009400472 6:63249153-63249175 TTCTAGAAAAATAAAGAGATTGG + Intergenic
1009497575 6:64370555-64370577 TTCTGAAAAAATGAGGAGGGGGG - Intronic
1009997495 6:70912706-70912728 TTCCAAAAAATTAAGGAGGAGGG - Intronic
1010561764 6:77359633-77359655 TTCTTTAAAATTAAGAAGGCTGG - Intergenic
1011383662 6:86769960-86769982 TTCCAAAAAAACAAGGAGGAGGG + Intergenic
1011631632 6:89331795-89331817 TTCTATTACAAAAAGGAAGGTGG - Intronic
1011861621 6:91764866-91764888 TTCTATAAAACTACTGAGGCCGG + Intergenic
1012690054 6:102299194-102299216 TTCTTTAGAAATAAGGATGAGGG - Intergenic
1012690408 6:102304049-102304071 TTCCATAAAATAAAGGAGGAAGG + Intergenic
1012803408 6:103864771-103864793 TGCTGTATAAATAAGGAGTGTGG + Intergenic
1012963454 6:105647116-105647138 TTCTAGAAAAAAAAAGAGGAAGG + Intergenic
1013277519 6:108600020-108600042 TTTTATATGTATAAGGAGGGTGG + Intronic
1013358461 6:109369825-109369847 TTTTTTAAAAATATGGAGGGAGG + Intronic
1013528732 6:110999480-110999502 TTCTATAAAATAAAGGAGTTGGG + Intronic
1014217008 6:118762099-118762121 TTTAAAAAAAAAAAGGAGGGGGG - Intergenic
1014243965 6:119047833-119047855 TTCCATAAAATTGAGGAGGAAGG + Intronic
1014433982 6:121401027-121401049 TACTATAAATATGTGGAGGGTGG + Intergenic
1014550415 6:122783984-122784006 GTTTATAAAAAAAAGGGGGGGGG - Exonic
1014988066 6:128036732-128036754 TTAAAAAAAAAAAAGGAGGGAGG - Intronic
1015097768 6:129436495-129436517 TGTAATAAAAAAAAGGAGGGGGG - Intronic
1016104474 6:140145249-140145271 TACTATAAAAATGGGGAGGAAGG + Intergenic
1017139981 6:151181625-151181647 TTATATAAAAATTAGCAGGCCGG - Intergenic
1017424826 6:154309575-154309597 TTCTCCAAGAACAAGGAGGGCGG - Intronic
1018325553 6:162663920-162663942 CTCTAAAAAAAAAAGGTGGGGGG + Intronic
1018338785 6:162826779-162826801 TACTGTAAAATTAAGGTGGGTGG + Intronic
1018460233 6:163991419-163991441 TTCAATCAAAAAAAGGAGGAAGG + Intergenic
1018537253 6:164834298-164834320 TTATATGAAAATAAGTAGTGAGG + Intergenic
1018646121 6:165950414-165950436 TTCTATCAAAAGAATGAGAGAGG + Intronic
1019913340 7:4115087-4115109 TTCTAAAAATTTAAGGAGGGGGG - Intronic
1020473586 7:8567942-8567964 TTCTATAAATATAAAGGGGTTGG - Intronic
1020830992 7:13095407-13095429 TTCTAAAAAAAAAAAGGGGGGGG - Intergenic
1021499409 7:21313720-21313742 TTTTAAAAAAATAAGTAAGGGGG + Intergenic
1021916801 7:25442371-25442393 TTCTTTAAGAATGCGGAGGGAGG + Intergenic
1023097152 7:36672954-36672976 TTCTATAAAAAAAATTATGGAGG - Intronic
1024042413 7:45565558-45565580 TTCTTTAAAAGTAAGGATGCTGG + Intergenic
1024348189 7:48334633-48334655 TTCAATAAAAATAGGGATAGAGG - Intronic
1025819928 7:64953172-64953194 TTATATTAAAATAATGAAGGAGG - Intergenic
1026292524 7:69020664-69020686 GTCTCTAAAAATAAAGGGGGAGG - Intergenic
1027066000 7:75124003-75124025 TTCTAAAAAAAAAAGGGGGGGGG - Intronic
1028017893 7:85738085-85738107 AACTATAAAAATTAGAAGGGGGG - Intergenic
1028693762 7:93684127-93684149 TTGTATAAAAATAAGCCAGGAGG + Intronic
1028767305 7:94574263-94574285 TTCCAAAAAATTAAGGAGGTGGG - Intergenic
1028949409 7:96618061-96618083 TTTTTAAAAAATGAGGAGGGGGG - Intronic
1029574990 7:101397535-101397557 CTCAAAAAAAAAAAGGAGGGGGG - Intronic
1030457310 7:109792016-109792038 TTCTATCAAAAAAAGGACAGAGG - Intergenic
1030919526 7:115364328-115364350 TTCTAAAAAATTTAAGAGGGGGG - Intergenic
1031033244 7:116758007-116758029 AGCTATAACAATAAAGAGGGTGG - Intronic
1031075028 7:117203544-117203566 TACTGAAAAAATGAGGAGGGGGG - Intronic
1031958825 7:127970387-127970409 CTCTGTAAAAATAAGGAGTTTGG + Intronic
1032723164 7:134567361-134567383 TCCTATAAAAAGAAAGAGCGAGG - Intronic
1032726922 7:134598602-134598624 TTCCAAAAAAATGAGGAGGAAGG - Intergenic
1032965876 7:137096833-137096855 TTCCAAAAAAATGAGGAGGAAGG + Intergenic
1033299576 7:140175352-140175374 TTCTGTAAAATTGGGGAGGGGGG + Intronic
1033384404 7:140857881-140857903 TTCCATAAAAATTAAAAGGGTGG + Intronic
1033917645 7:146347205-146347227 TGCTATAAAAATAGAGATGGAGG + Intronic
1034363990 7:150529782-150529804 TTCCAAAAAATTAAGGAGGAGGG - Intergenic
1035856722 8:2983750-2983772 TTCTACAAAAATAAGAAGTTAGG - Intronic
1036555256 8:9854107-9854129 TTTTATAAAAATCATGGGGGAGG + Intergenic
1037028132 8:14065238-14065260 TTCCAAAAAATTAAAGAGGGGGG - Intergenic
1038112811 8:24518156-24518178 TTCGATACAAGTAAAGAGGGAGG + Intronic
1038136106 8:24787460-24787482 TTCTATGAGCATAAGGAGGAAGG - Intergenic
1038886245 8:31666013-31666035 TTCTATAAAAACACGGTAGGAGG - Intronic
1038960501 8:32513044-32513066 TTCTATAAAGACAAAGAGGTAGG + Intronic
1039629384 8:39092368-39092390 TTTTATAAAGATAAAGGGGGTGG - Intronic
1040540623 8:48351032-48351054 TTCTAAAAAATTGAGGAGGAGGG + Intergenic
1040980430 8:53241405-53241427 TTCTAGAAAAGAAAGGAGGGAGG + Intronic
1041238485 8:55828521-55828543 TTATAAAAAAAAAAGGGGGGGGG - Intergenic
1041917058 8:63148553-63148575 TGCTAAAAAAAAAAGGGGGGGGG - Intergenic
1042320068 8:67465989-67466011 TTCCAAAAAATTAAGGAGGTAGG - Intronic
1042433665 8:68738891-68738913 TTCTAAAAAATTAATGAGGAGGG + Intronic
1042450729 8:68942526-68942548 GTCTCAAAAAAAAAGGAGGGGGG - Intergenic
1043497118 8:80813979-80814001 TTCTATAAAAATGGGAAGGAAGG - Intronic
1044647452 8:94459517-94459539 TTGCATCAAAATAAGAAGGGAGG + Intronic
1046565836 8:115899934-115899956 TGCTATAAAAATAAGGGGGTGGG - Intergenic
1046800725 8:118423599-118423621 TGATATAAAAATAAGCATGGGGG - Intronic
1047822566 8:128537637-128537659 GTTTATAAAAATAAGGTGGTTGG - Intergenic
1047826096 8:128577423-128577445 TTTTATAAAAAGATGGAGAGAGG + Intergenic
1048511485 8:135066365-135066387 TTCTATGAAGCTAAGGATGGAGG - Intergenic
1048512377 8:135074669-135074691 TGCTATGAAAATACAGAGGGAGG + Intergenic
1048679188 8:136820316-136820338 TTCTGAAAAATTAAGGAGGAGGG - Intergenic
1048685152 8:136896665-136896687 TTTCACAAAAATAAGGAGGTGGG + Intergenic
1049712337 8:144070972-144070994 GTTCTTAAAAATAAGGAGGGAGG + Intergenic
1050236249 9:3583961-3583983 TTCTATTATAATTAGAAGGGAGG - Intergenic
1050242709 9:3654901-3654923 TTCTAAAAAATTGAAGAGGGGGG - Intergenic
1050556498 9:6793837-6793859 TTATATAAAAAAAAAGAGGCCGG - Intronic
1050565730 9:6880786-6880808 ATCTTTAAAAAAAAGGAGGAAGG - Intronic
1051311922 9:15784488-15784510 TTCTGTAAAAAGGAGGAGAGGGG - Exonic
1052145779 9:25046147-25046169 TTCCATTGAATTAAGGAGGGAGG - Intergenic
1052193075 9:25680038-25680060 ATCTCAAAAAATAAGGAAGGGGG + Intergenic
1052364157 9:27592870-27592892 TTCCATAATATTAAGGAGAGGGG + Intergenic
1052524984 9:29605376-29605398 TTATAAAAAAATGAGGAGGTGGG - Intergenic
1052748160 9:32461788-32461810 TTCTAGAAAAATAAAAATGGGGG - Intronic
1053385096 9:37680799-37680821 TTCTATAATAAAAAGAGGGGAGG + Intronic
1053500405 9:38584356-38584378 ATCTATACAAAGAAGGTGGGTGG + Intergenic
1053660715 9:40275528-40275550 ATCTATACAAAGAAGGTGGGTGG - Intronic
1053911091 9:42904873-42904895 ATCTATACAAAGAAGGTGGGTGG - Intergenic
1054523895 9:66100756-66100778 ATCTATACAAAGAAGGTGGGTGG + Intergenic
1054680465 9:67911521-67911543 ATCTATACAAAGAAGGTGGGTGG - Intergenic
1054858443 9:69925814-69925836 GACTATAAAAATTAAGAGGGGGG - Intergenic
1054924425 9:70575186-70575208 TTCATTTAAAATGAGGAGGGAGG - Intronic
1055655243 9:78444500-78444522 TTCTACAAAAATAAAGACGGGGG - Intergenic
1055903163 9:81264188-81264210 TTTTTTAAAAATAACGAGGTGGG + Intergenic
1056736611 9:89215214-89215236 TTCTGTAACAAAAAGGAAGGGGG + Intergenic
1056835794 9:89954157-89954179 GTCAAGAAAAATAAGGAGGGGGG - Intergenic
1058103564 9:100944104-100944126 TTCTAAAAAATTAAAGAGGAAGG - Intergenic
1058471945 9:105288821-105288843 TTCTAGAAATATAATGAGAGAGG + Intronic
1059578623 9:115519399-115519421 TTCTATAAAGATAAAAAGGGGGG + Intergenic
1059897001 9:118877483-118877505 TTCTGTACAAATGAGGAGGTTGG - Intergenic
1060066338 9:120504422-120504444 TCCTTTATAATTAAGGAGGGAGG - Intronic
1060322868 9:122581644-122581666 TTCTTTAAAAATAAAGACAGAGG + Intergenic
1061410889 9:130420894-130420916 TTAAAAAAAAATAAGGAGGCTGG - Intronic
1061534230 9:131237707-131237729 TTCTATAAAAAAAAAAAAGGTGG + Intergenic
1061857702 9:133451556-133451578 TTATTTAAAACTAAGGAGGCTGG - Intronic
1203706419 Un_KI270742v1:52900-52922 ATCTATACAAAGAAGGTGGGTGG - Intergenic
1185514835 X:691756-691778 TTCTAAAAAAAAAAGGTCGGGGG - Intergenic
1185579723 X:1202663-1202685 TCCTATAAAAGTAATGAGGACGG - Intronic
1185608294 X:1379759-1379781 TTCTCTAAAAAAAAGGAGACAGG - Intronic
1185923810 X:4124358-4124380 CTCTGCAAAAGTAAGGAGGGTGG - Intergenic
1186108216 X:6227945-6227967 TTCTTAAAGAATAAGGGGGGGGG + Intronic
1186815443 X:13233181-13233203 TGCTATAAAAAGAGGAAGGGAGG - Intergenic
1187620600 X:21049160-21049182 TTCTAAAAAAATGAGGAGGAGGG + Intergenic
1188534430 X:31180686-31180708 TCCTATAAACATATGGAAGGAGG + Intronic
1188710664 X:33393350-33393372 TTCTAAAAAACTGAGGAGGAGGG + Intergenic
1189049240 X:37627053-37627075 TTCTATAGAAAAAATGAGGATGG + Intronic
1189716705 X:43874486-43874508 TACTATAAAGATAAGGTGGATGG - Intronic
1189898060 X:45676578-45676600 TTCCATAAAATTGAGGAGGAGGG + Intergenic
1190103442 X:47541037-47541059 GTTTATAACAAAAAGGAGGGTGG + Intergenic
1190292717 X:49003287-49003309 TTCTACGAAAATAAGAAGGCTGG - Intergenic
1190572262 X:51795510-51795532 TACTACAAAAATCAGGAAGGGGG - Intergenic
1190622548 X:52302006-52302028 TTCTAGCAAAATAGGGAGGCAGG + Intergenic
1190955122 X:55185673-55185695 TTTTTTAAAAAAAAGGCGGGGGG + Intronic
1191018735 X:55838597-55838619 TTCCAGAAAACTGAGGAGGGAGG - Intergenic
1191611977 X:63126132-63126154 TTCTTAAAAAGTAAGGAGGAAGG + Intergenic
1192076001 X:67997489-67997511 TTCTAAAAAAAAAATGAGGAGGG - Intergenic
1192700869 X:73470513-73470535 TTCTAAAAAATTGAGGAGGAGGG - Intergenic
1192892240 X:75402836-75402858 TTCCAGAAAAATGAGGAGGAAGG + Intronic
1194219420 X:91172835-91172857 TTCCATAAAACTGAGGAGGAGGG - Intergenic
1194304287 X:92223222-92223244 ATATATACAAATAAGTAGGGAGG - Intronic
1194467591 X:94253250-94253272 CTCTATACACATTAGGAGGGTGG - Intergenic
1196468507 X:115997168-115997190 TTCAAAAAAAATTAGGAGGAGGG - Intergenic
1197088215 X:122504784-122504806 TTCTACAAAAATAAGCAATGGGG - Intergenic
1197158808 X:123300261-123300283 TTCTAAAAAATTGAGGAGGAGGG - Intronic
1197568200 X:128114836-128114858 TTTTAAAAAGAAAAGGAGGGAGG - Intergenic
1197632753 X:128881042-128881064 ATCTATCAAAATAAGGAGGTTGG + Intergenic
1198769199 X:140110407-140110429 TTCAAAAAAAAGAAGGGGGGGGG + Intergenic
1199251905 X:145673235-145673257 TTCTATCCAAATAAGGGAGGAGG - Intergenic
1199476430 X:148251382-148251404 TTCTTGAAAAATACGGAGAGCGG - Intergenic
1199641151 X:149863361-149863383 GTCAACAAAAATAAGCAGGGGGG + Intergenic
1200336965 X:155361081-155361103 TTCTGGAAAAAAAAGGGGGGGGG + Intergenic
1200349505 X:155480146-155480168 TTCTGGAAAAAAAAGGGGGGGGG - Intergenic
1200555933 Y:4636597-4636619 TTCCATAAAACTGAGGAGGAGGG - Intergenic