ID: 901653505

View in Genome Browser
Species Human (GRCh38)
Location 1:10756207-10756229
Sequence CGTTGCTGCCTCTGGAGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 184}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901653497_901653505 14 Left 901653497 1:10756170-10756192 CCGCAAGCCGCTGCCAGCCTGCA 0: 1
1: 0
2: 0
3: 26
4: 248
Right 901653505 1:10756207-10756229 CGTTGCTGCCTCTGGAGGTCAGG 0: 1
1: 0
2: 0
3: 12
4: 184
901653498_901653505 7 Left 901653498 1:10756177-10756199 CCGCTGCCAGCCTGCACTTCTGC 0: 1
1: 0
2: 5
3: 50
4: 445
Right 901653505 1:10756207-10756229 CGTTGCTGCCTCTGGAGGTCAGG 0: 1
1: 0
2: 0
3: 12
4: 184
901653499_901653505 1 Left 901653499 1:10756183-10756205 CCAGCCTGCACTTCTGCTCTCTC 0: 1
1: 1
2: 2
3: 62
4: 623
Right 901653505 1:10756207-10756229 CGTTGCTGCCTCTGGAGGTCAGG 0: 1
1: 0
2: 0
3: 12
4: 184
901653495_901653505 20 Left 901653495 1:10756164-10756186 CCACTCCCGCAAGCCGCTGCCAG 0: 1
1: 0
2: 0
3: 18
4: 230
Right 901653505 1:10756207-10756229 CGTTGCTGCCTCTGGAGGTCAGG 0: 1
1: 0
2: 0
3: 12
4: 184
901653494_901653505 23 Left 901653494 1:10756161-10756183 CCACCACTCCCGCAAGCCGCTGC 0: 1
1: 0
2: 0
3: 16
4: 220
Right 901653505 1:10756207-10756229 CGTTGCTGCCTCTGGAGGTCAGG 0: 1
1: 0
2: 0
3: 12
4: 184
901653496_901653505 15 Left 901653496 1:10756169-10756191 CCCGCAAGCCGCTGCCAGCCTGC 0: 1
1: 0
2: 0
3: 18
4: 225
Right 901653505 1:10756207-10756229 CGTTGCTGCCTCTGGAGGTCAGG 0: 1
1: 0
2: 0
3: 12
4: 184
901653492_901653505 25 Left 901653492 1:10756159-10756181 CCCCACCACTCCCGCAAGCCGCT 0: 1
1: 0
2: 0
3: 6
4: 168
Right 901653505 1:10756207-10756229 CGTTGCTGCCTCTGGAGGTCAGG 0: 1
1: 0
2: 0
3: 12
4: 184
901653500_901653505 -3 Left 901653500 1:10756187-10756209 CCTGCACTTCTGCTCTCTCCCGT 0: 1
1: 0
2: 4
3: 20
4: 241
Right 901653505 1:10756207-10756229 CGTTGCTGCCTCTGGAGGTCAGG 0: 1
1: 0
2: 0
3: 12
4: 184
901653493_901653505 24 Left 901653493 1:10756160-10756182 CCCACCACTCCCGCAAGCCGCTG 0: 1
1: 0
2: 0
3: 8
4: 99
Right 901653505 1:10756207-10756229 CGTTGCTGCCTCTGGAGGTCAGG 0: 1
1: 0
2: 0
3: 12
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901653505 Original CRISPR CGTTGCTGCCTCTGGAGGTC AGG Intronic
900314903 1:2051642-2051664 CGTCCCTGCCTCTGGGGCTCAGG - Intronic
900380777 1:2382773-2382795 CGTTGCTGCCCCTGCTGGCCTGG - Intronic
900965592 1:5956167-5956189 AGTTGCTGCCTCTTGAGATGGGG - Intronic
901351191 1:8598397-8598419 CGTTGCTTCTGCTGGAGGGCCGG - Intronic
901653505 1:10756207-10756229 CGTTGCTGCCTCTGGAGGTCAGG + Intronic
901927794 1:12578002-12578024 CGTGGCTTCCCCTGGAGGGCTGG - Intronic
903153913 1:21431169-21431191 GGTTGCTACCCCTGGAGGTCTGG + Intergenic
903222183 1:21875129-21875151 CCTCGCAGCCTCTGGAGATCTGG - Intronic
903316608 1:22512811-22512833 CTGTGCTTCCTCTGGAGGCCTGG + Intronic
904212223 1:28893557-28893579 CGCTGCTGCCTCTAGTGGGCTGG + Intronic
906289478 1:44610489-44610511 CCTCGCTCCCTCAGGAGGTCAGG - Intronic
906829578 1:49017118-49017140 CATAGCTACCTCTGGAAGTCTGG + Intronic
907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG + Intronic
911044217 1:93615487-93615509 CCTCTCTGACTCTGGAGGTCTGG + Intronic
916172387 1:162010755-162010777 GGGTGCTGGCTCTGGAGATCAGG + Intronic
916257525 1:162804910-162804932 AGAGGCTGCCTCTGGAGCTCTGG - Intronic
918003441 1:180520031-180520053 TGTTGCTGCCTCAGGAATTCAGG + Intergenic
919856437 1:201709455-201709477 CTCTGCAGCCTCTGGAGCTCTGG + Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
922077797 1:222265142-222265164 GGTGGCTGCCTCTGGAGATGGGG + Intergenic
922199811 1:223392559-223392581 CCTTGCTGGAACTGGAGGTCAGG + Intergenic
1063017402 10:2092716-2092738 AGTTGCTGCTCCTGGAGGTGTGG - Intergenic
1063136131 10:3218035-3218057 CGCTGCTGCATGTGGGGGTCAGG - Intergenic
1063865584 10:10361946-10361968 TGCTGCTGCCACTGGGGGTCTGG - Intergenic
1063953418 10:11244696-11244718 CGTTGCTTCCTCTGTTGGTTAGG + Intronic
1066723974 10:38370596-38370618 AGAGGCTGCCTCTGGAGCTCTGG - Intergenic
1068612529 10:59076149-59076171 CTTTGGTGCCCCTGGAGCTCTGG - Intergenic
1069633245 10:69910332-69910354 TGTGACTGCCTCTTGAGGTCAGG + Intronic
1070916874 10:80160758-80160780 GGTTGCTGAGTGTGGAGGTCAGG - Intronic
1071124894 10:82321905-82321927 CTTTGATGCCCCAGGAGGTCTGG - Intronic
1072958363 10:99906818-99906840 CCTCGCTGCTTCTGTAGGTCAGG - Intronic
1073624142 10:105079125-105079147 AGTTTCTGATTCTGGAGGTCTGG - Intronic
1075316193 10:121455483-121455505 CGTTTCTGCCTCTGCTGATCTGG + Intergenic
1076221059 10:128733615-128733637 TGGAGCTGCCTCTGCAGGTCTGG + Intergenic
1078753964 11:14191186-14191208 CGCTGCTGCCTCTGGTGGCCTGG + Intronic
1079328427 11:19513936-19513958 CCATGCTCCCTCTGGAGCTCAGG - Intronic
1080322265 11:31024619-31024641 AGTGGCTGCCTCTGGATGCCAGG - Intronic
1081552383 11:44125859-44125881 GGATGCTGACTCTTGAGGTCAGG + Intronic
1082013154 11:47464539-47464561 CGCTGCTGCCTGTGGGGGACGGG - Intergenic
1087933625 11:104006223-104006245 CATTTCTGCTTCTGTAGGTCTGG - Intronic
1089996957 11:122917518-122917540 AGTTTCTGACTCAGGAGGTCTGG - Intronic
1090332648 11:125943763-125943785 CCCTGCTGCCTCGGGAGGTGAGG - Intergenic
1091696865 12:2633509-2633531 CCGTGTTGCCTCTGGAGTTCCGG - Intronic
1092636086 12:10451092-10451114 CGTTGCTGCCTCTTTGGGTTTGG + Exonic
1093111377 12:15156366-15156388 CTTTGCTGGATCTGGAGTTCAGG + Intronic
1096642663 12:53006644-53006666 GGTTACTGCCTCTGGATGTTTGG + Intronic
1096710464 12:53452103-53452125 GGCTGCTGCCTCTGCTGGTCTGG - Intronic
1098230402 12:68367227-68367249 TGCTGCTGCCTTTGGAGGTTGGG - Intergenic
1099526222 12:83721863-83721885 AGTAGCGGCTTCTGGAGGTCAGG + Intergenic
1102426769 12:112849928-112849950 CTGGGCTGCCTCTGGGGGTCAGG + Intronic
1103412481 12:120722299-120722321 CTTTGCTGCTTCTGAAAGTCTGG + Exonic
1104891584 12:132142757-132142779 CGCAGCTGCTTCTGCAGGTCAGG + Exonic
1105454225 13:20525713-20525735 CGCTGCTGCCCCTGGAGCCCGGG - Intronic
1107779105 13:43879516-43879538 CGCTGCTGCCTCAGCAGTTCCGG - Exonic
1114062011 14:19026729-19026751 CGTTGCTGCTCCTTGAAGTCCGG + Intergenic
1114100249 14:19373268-19373290 CGTTGCTGCTCCTTGAAGTCCGG - Intergenic
1115158847 14:30370004-30370026 CATTTCTGACTCAGGAGGTCAGG - Intergenic
1115641426 14:35337856-35337878 TGCTGCTGCCTCCTGAGGTCAGG + Intergenic
1117072588 14:52069557-52069579 CGCTCCTGGCTCTGGAGGCCTGG + Intergenic
1117424629 14:55580868-55580890 CGCCGCTGCCTCCGGCGGTCTGG + Intronic
1117953170 14:61102905-61102927 GGTTGTTGCCTTTGGAGGCCAGG + Intergenic
1122503319 14:102216127-102216149 CGGTGCTGTCTCTGGAGTGCGGG + Intronic
1125748290 15:42012122-42012144 CTTTGCTGTCTCTGGGGCTCAGG + Intronic
1127455227 15:59150826-59150848 CGTTTCTGATTCTGTAGGTCTGG - Intronic
1130768077 15:86893271-86893293 GGTGGCTGCCTCTTGAGGTCTGG + Intronic
1131134706 15:89925017-89925039 GGTGGCTGCCTCTGGGGGACTGG + Intergenic
1131552699 15:93371914-93371936 AGTTGCTGCCGCAGGTGGTCAGG - Intergenic
1132711258 16:1268989-1269011 CGTTGCCGCTTCTGGTGGGCGGG + Intergenic
1133002345 16:2857682-2857704 TGTTCCTGCCGCAGGAGGTCAGG - Intronic
1133739193 16:8639146-8639168 CCTGGCTGCCACTGGAGGTGAGG + Exonic
1136264589 16:29107475-29107497 GCTTGCTGCCTCTGGTGGCCCGG - Intergenic
1136268438 16:29134059-29134081 CATTGCTGCCTGTGGACGCCGGG - Intergenic
1141345834 16:83244910-83244932 CGTTTTTCCTTCTGGAGGTCAGG - Intronic
1141667265 16:85472298-85472320 CTGTGCTCCCTCTGGAGGCCTGG + Intergenic
1143399456 17:6633861-6633883 AGTGGCTGCCTCTGGAGGGGAGG + Intronic
1144770815 17:17758411-17758433 AGGTGCTGCCTCTGAAGGCCTGG - Intronic
1144773926 17:17774653-17774675 CCTTGCTGGCTGTGGAGGTGCGG - Intronic
1146587221 17:34092593-34092615 CTTTACTGCCTCTAGAAGTCAGG - Intronic
1146739799 17:35273697-35273719 AGTTACTGCCTCTGGAGGAAGGG - Intergenic
1147438742 17:40433836-40433858 CTGTGCTGCCTCTGGAGGTGGGG + Intergenic
1148251518 17:46085163-46085185 TGTTGCTGCTGCTGGAGGTAAGG + Intronic
1149189304 17:54039583-54039605 AGTTGCTGCTTTTGGAGGCCTGG + Intergenic
1151231946 17:72691139-72691161 AGATGCTGACTCTGGAGGTGAGG + Intronic
1151951559 17:77357004-77357026 GGTTGATGCTTCTGGACGTCTGG - Intronic
1152935927 17:83136745-83136767 AGTTGCTGCCTCTAGAAATCAGG - Intergenic
1153496454 18:5704641-5704663 CGTTTCTGACTCCAGAGGTCTGG + Intergenic
1153689699 18:7579278-7579300 AGTTTCTGACTCTGTAGGTCTGG - Intronic
1153768454 18:8396682-8396704 TGCTGCTGACTTTGGAGGTCTGG - Intronic
1155273821 18:24166999-24167021 CCTTGCTGGGTCTGGAGGGCTGG + Intronic
1155432274 18:25772035-25772057 CTTTGGTGCCTCAGGTGGTCAGG + Intergenic
1157370375 18:47105705-47105727 TGTGGCTGACTCTGGAGGTGTGG + Intergenic
1157884067 18:51349429-51349451 GGTTGCTGGCTCTGAAGGGCAGG - Intergenic
1158878161 18:61752402-61752424 GGATGCTGCCTCAGGAGGTGAGG - Intergenic
1158920740 18:62187976-62187998 CGTTGGGGGCGCTGGAGGTCGGG + Exonic
1162435116 19:10653654-10653676 CGTTGCTGCCCCTTGAGCCCGGG - Intergenic
1163017098 19:14463312-14463334 TGTTGCTGCTACTGCAGGTCTGG + Intronic
1163410312 19:17149871-17149893 CCGTGCTGCATCTGCAGGTCTGG - Intronic
1165433826 19:35786409-35786431 CTGTGCAGCCTCTGGAGGCCTGG - Intronic
1166889486 19:45981798-45981820 CGGTGGTGCCGCTGGAGGTAGGG - Intergenic
926217096 2:10912351-10912373 CGCCGCTGCCGCTGGGGGTCCGG - Exonic
928125450 2:28612354-28612376 CGTTCCTCACACTGGAGGTCAGG - Intronic
928794222 2:34997167-34997189 GATGGCTGCCTCTGGAAGTCAGG + Intergenic
932586449 2:73032708-73032730 CTTTGCTGCCTTGGGAGGTTTGG - Intronic
935713941 2:105923407-105923429 AGTTTCTGACTCAGGAGGTCTGG + Intergenic
936264843 2:110996159-110996181 CGTTGCTTGCTCTAGAGGCCAGG + Intronic
938062908 2:128266506-128266528 GGTCGCTACCCCTGGAGGTCTGG - Exonic
940127995 2:150348821-150348843 AGTTGTTGCCTCTGGAGAGCAGG + Intergenic
942482423 2:176403600-176403622 AGTTGATACCTCTGGAGGTAGGG - Intergenic
945288269 2:208103789-208103811 GGTTGCTGATTCAGGAGGTCTGG + Intergenic
946369922 2:219274534-219274556 CCTAGCTGCCTCAGGAGGTCTGG - Intronic
946432895 2:219635022-219635044 AGTTGCTGCATGTGGAAGTCTGG + Intronic
947523599 2:230865762-230865784 CGCTGCGGCCTCTGGACGTCGGG + Intronic
947723268 2:232381737-232381759 CGTTGCTTCCTCTGCTGGCCGGG + Exonic
948216404 2:236236706-236236728 CGTTGCTGCCCCTGCTGGGCAGG + Intronic
948350134 2:237333514-237333536 CCTTGCTGGCTGTGGAGGTGGGG + Exonic
948516837 2:238509494-238509516 CTCCACTGCCTCTGGAGGTCAGG - Intergenic
948760083 2:240184905-240184927 CCTTGCTGCCTCTGCGGGTGGGG - Intergenic
1169239766 20:3966666-3966688 AGTTCCTGCATCTGGAGGCCAGG - Intronic
1173548897 20:43918481-43918503 AGTAGTTGCCTCTGGAGGTGGGG - Intronic
1173853743 20:46236204-46236226 CGTTTCTGGCTCACGAGGTCTGG - Intronic
1174658738 20:52192379-52192401 CGTTTCTGCTTCAGTAGGTCTGG + Intronic
1174855778 20:54043722-54043744 TGTTTCTGACTCAGGAGGTCTGG + Intronic
1176343002 21:5715440-5715462 CGTGGCTGACTCTGGAGCCCAGG + Intergenic
1176475256 21:7147591-7147613 CGTGGCTGACTCTGGAGCCCAGG + Intergenic
1176501825 21:7609016-7609038 CGTGGCTGACTCTGGAGCCCAGG - Intergenic
1176537323 21:8113509-8113531 CGTGGCTGACTCTGGAGCCCAGG + Intergenic
1177812624 21:25940869-25940891 CTTTGCTGATTCAGGAGGTCAGG + Intronic
1178485578 21:33018254-33018276 AGTAGTTGCCTCTGGGGGTCTGG + Intergenic
1179185901 21:39085108-39085130 AGTTTCTGACTCAGGAGGTCTGG - Intergenic
1179564241 21:42236438-42236460 CTTTGCTGTCTCTGGAGACCAGG + Intronic
1179884249 21:44306667-44306689 CGTTCATGCCTGTGGAGGTCAGG - Exonic
1183151664 22:36042476-36042498 GGTTGCTGCCTCTGGCTGTAGGG + Intergenic
1203242267 22_KI270733v1_random:29913-29935 CGTGGCTGACTCTGGAGCCCAGG + Intergenic
949970629 3:9399928-9399950 AGCTGCTGGCTCTGGAGCTCTGG + Intronic
950223443 3:11214121-11214143 GTTTGCAGCCTCTGGAGTTCAGG - Intronic
953947865 3:47164353-47164375 CGGTGCCGCCTCTCCAGGTCCGG - Intergenic
954004569 3:47580474-47580496 CGTTGCTGCCTCTGTGGCTGAGG - Exonic
956208120 3:66775129-66775151 AGTAGTTGCCTCTGGAGGTTTGG + Intergenic
956274185 3:67480381-67480403 AGTTTCTGACTCTGAAGGTCTGG + Intronic
959805123 3:110541907-110541929 CCTTGCTTTCTCTGGATGTCTGG - Intergenic
961332640 3:126152036-126152058 CCTTGCTGCAGCTGGAGGACAGG - Intronic
961824498 3:129592049-129592071 CGTTCCTGCCTCAGGACCTCTGG + Intronic
962704124 3:138026966-138026988 TGTGGCTGCCTCTGGAATTCTGG - Intronic
963440039 3:145328528-145328550 AGTTGTTGCCTCTGCAGGTGGGG - Intergenic
963706735 3:148697842-148697864 CGTTGCTGCTTCTTGGGTTCCGG - Exonic
966621175 3:181965934-181965956 GGGTGCTGACCCTGGAGGTCAGG + Intergenic
969476740 4:7426321-7426343 CTTTGCTGGCTTTGCAGGTCAGG + Intronic
969480356 4:7443694-7443716 GGTTTCTGACTCTGGAGGTGTGG - Intronic
969551332 4:7869763-7869785 CATTGCAGCTCCTGGAGGTCAGG - Intronic
971391887 4:26193826-26193848 TATTGCAGGCTCTGGAGGTCAGG - Intronic
972942282 4:44210960-44210982 CATTGCTGCCTCTAGAGGACTGG - Intronic
985550956 5:533412-533434 GGTTGCTGCCTCCGGATGTGCGG + Intergenic
985656417 5:1133844-1133866 TGTTGCTGCCTCGGTTGGTCAGG - Intergenic
986343983 5:6817387-6817409 CTTTGCTGCCTCTGGGTGGCTGG + Intergenic
987053208 5:14165837-14165859 CGTTCCTACCTCTGGAGGCTGGG - Intronic
987453943 5:18119955-18119977 GGTTGGTGCCCCTCGAGGTCAGG + Intergenic
992044391 5:72870731-72870753 AGTAGGTGCCTCTGGAGGTTGGG + Intronic
992505083 5:77378779-77378801 AGTTGCTGACTCAGTAGGTCTGG - Intronic
992868484 5:80982077-80982099 CTTTTCTGCCTGTGAAGGTCTGG + Intronic
993579298 5:89639538-89639560 TCTTGCTGCCACTGGAGGCCAGG + Intergenic
998140973 5:139699248-139699270 CTTTGCTACCCCTTGAGGTCAGG + Intergenic
1001825979 5:174745377-174745399 CGCTGCAGCCTCTGGAGGGGAGG + Intergenic
1001993296 5:176134544-176134566 CCTAGCTGCCTCTTGAGGTCCGG + Intergenic
1002000923 5:176195914-176195936 CCCAGCTGCCTCTTGAGGTCTGG + Intergenic
1002253411 5:177943058-177943080 CCCAGCTGCCTCTTGAGGTCTGG - Intergenic
1003040870 6:2686134-2686156 GATTCCTGCCTCAGGAGGTCTGG - Intronic
1005504402 6:26457509-26457531 AGTTGCTGGCTTTGGAGGTTGGG - Intergenic
1010332295 6:74637576-74637598 CTTAGCTGCATATGGAGGTCAGG - Intergenic
1017740334 6:157400647-157400669 CGCTGCTGCCCATGGATGTCAGG + Intronic
1019518831 7:1451540-1451562 CGTTGCTGCCTGTGGGGTCCCGG + Intronic
1019647556 7:2139233-2139255 CATTGCTGGCTCAGGGGGTCGGG - Intronic
1019733375 7:2639115-2639137 TGTTGCTTCCTCTGGAGGAGGGG + Intronic
1021540500 7:21752051-21752073 AGTTTCTGCTTCAGGAGGTCTGG - Intronic
1024285820 7:47756657-47756679 GCTTGCTGCCTCTGGGGTTCAGG + Intronic
1029284891 7:99458619-99458641 CGGTCCTGCCTCTGAAGGACGGG - Intronic
1035942850 8:3923192-3923214 AGTGGCTGACTCTGGAGCTCAGG + Intronic
1036594084 8:10196473-10196495 CTTTGCTGCTTCTGTGGGTCAGG + Intronic
1037401130 8:18496367-18496389 AGTTGTAGCCTCTTGAGGTCTGG - Intergenic
1037891328 8:22625253-22625275 CGCTGCTGCTGCTGGAGGGCTGG + Intronic
1039818383 8:41114787-41114809 CGGTGTGGCCTCAGGAGGTCAGG + Intergenic
1040988424 8:53322136-53322158 AGTTGCTGGCTCAGTAGGTCAGG - Intergenic
1048274667 8:133057175-133057197 TGTTGGTGCCTCTTCAGGTCAGG + Intronic
1048474385 8:134730192-134730214 CATTGCTCCCTCTGGAGATGAGG - Intergenic
1048700757 8:137086381-137086403 CTTAGCTGACTCTGGAGGTCCGG - Intergenic
1060846136 9:126839077-126839099 CGCTGCTGCTTCTCGAGGGCAGG - Intergenic
1061780671 9:132994409-132994431 CTTTGCTGGCTCTGGTGCTCTGG - Intergenic
1203773998 EBV:62784-62806 CGCTGATGCCTCTGGAGCTGGGG - Intergenic
1203458595 Un_GL000220v1:12990-13012 CGTGGCTGACTCTGGAGCCCAGG + Intergenic
1185623126 X:1465489-1465511 CTCTCCTGCCTCTGGAGGCCGGG + Exonic
1189967672 X:46391388-46391410 AGTTTCTGATTCTGGAGGTCTGG - Intergenic
1191061202 X:56298496-56298518 CCTGGATGCTTCTGGAGGTCTGG - Intergenic
1192495501 X:71614326-71614348 TGTTACTGCCTCTGGAGGACGGG - Intergenic
1193719430 X:84971049-84971071 GGTTGGTGCCCCTTGAGGTCAGG - Intergenic
1198426747 X:136528462-136528484 AGTAGCTGCATCTGGAGGTTGGG - Intergenic
1199972683 X:152872485-152872507 CGATGCAGCCTCTGGGGGTGTGG + Intergenic
1200106342 X:153715355-153715377 CCACGCTGCCTCTGGAGGTCAGG + Intronic
1200123945 X:153804507-153804529 CGCTGTTGCCTCCGGAGGCCCGG + Exonic