ID: 901653834

View in Genome Browser
Species Human (GRCh38)
Location 1:10757938-10757960
Sequence CAGAGTGGCCAGGACGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 275}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901653834_901653843 23 Left 901653834 1:10757938-10757960 CCATCCACGTCCTGGCCACTCTG 0: 1
1: 0
2: 2
3: 18
4: 275
Right 901653843 1:10757984-10758006 CACTGAGGGCATCCTACCTTAGG 0: 1
1: 0
2: 0
3: 8
4: 94
901653834_901653844 24 Left 901653834 1:10757938-10757960 CCATCCACGTCCTGGCCACTCTG 0: 1
1: 0
2: 2
3: 18
4: 275
Right 901653844 1:10757985-10758007 ACTGAGGGCATCCTACCTTAGGG 0: 1
1: 0
2: 0
3: 3
4: 77
901653834_901653838 -3 Left 901653834 1:10757938-10757960 CCATCCACGTCCTGGCCACTCTG 0: 1
1: 0
2: 2
3: 18
4: 275
Right 901653838 1:10757958-10757980 CTGCCTTTCTTTCCAGTCACTGG 0: 1
1: 0
2: 5
3: 38
4: 421
901653834_901653840 8 Left 901653834 1:10757938-10757960 CCATCCACGTCCTGGCCACTCTG 0: 1
1: 0
2: 2
3: 18
4: 275
Right 901653840 1:10757969-10757991 TCCAGTCACTGGATGCACTGAGG 0: 1
1: 0
2: 1
3: 11
4: 180
901653834_901653842 9 Left 901653834 1:10757938-10757960 CCATCCACGTCCTGGCCACTCTG 0: 1
1: 0
2: 2
3: 18
4: 275
Right 901653842 1:10757970-10757992 CCAGTCACTGGATGCACTGAGGG 0: 1
1: 0
2: 0
3: 12
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901653834 Original CRISPR CAGAGTGGCCAGGACGTGGA TGG (reversed) Intronic
900339541 1:2181474-2181496 CTGAGAGGCCAGGACGTCCATGG + Intronic
901399262 1:9004865-9004887 CCGAGGGGACAGGACCTGGAGGG + Exonic
901653834 1:10757938-10757960 CAGAGTGGCCAGGACGTGGATGG - Intronic
901800046 1:11703335-11703357 AAGGATGGGCAGGACGTGGACGG + Intronic
902513620 1:16978877-16978899 CAGAGCGGCCAGGCCGGGCAGGG + Intronic
902778353 1:18689160-18689182 CAGCGAGGCCAGCCCGTGGATGG - Intronic
903334268 1:22614455-22614477 CAGAGGGGGCAAGAAGTGGATGG - Intergenic
903878537 1:26492805-26492827 GAGACAGGCCAGGAAGTGGAGGG + Intergenic
904418751 1:30378177-30378199 CAGAGAGGCCAGGGCCTGGGAGG + Intergenic
904561079 1:31397675-31397697 CAGTGAGGCCAGGAAGTTGAGGG - Intergenic
905019076 1:34796037-34796059 CAGTGTGGCCAGGGCGACGATGG - Intronic
905461941 1:38127831-38127853 CAGAATGGCAAGGAGGAGGAGGG - Intergenic
905481483 1:38264961-38264983 TAGTAGGGCCAGGACGTGGATGG + Intergenic
906208840 1:44001112-44001134 CAGAGTTGCCAGGACGTGCAGGG - Intronic
906552663 1:46678594-46678616 AAGACTGGCCAGGACGTGGATGG - Exonic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
908040582 1:60108216-60108238 CAGAATGGCCACTCCGTGGAAGG - Intergenic
909291735 1:73891203-73891225 CAGAGAGGTCAGGATGTGAAGGG + Intergenic
910235036 1:85026665-85026687 CAGAATGGCGTGGACCTGGAAGG + Intronic
912390432 1:109298815-109298837 CAGAGTGGCCATGCAGAGGAAGG - Intronic
915234467 1:154470250-154470272 CACTGGAGCCAGGACGTGGAGGG + Intronic
915267743 1:154731095-154731117 CAGGGTTGCCAGTAGGTGGATGG - Intronic
917845369 1:179015766-179015788 CAGAGTGCTCAGGACACGGAGGG - Intergenic
918593224 1:186262850-186262872 CAGAGTGAACTGGAAGTGGATGG + Intergenic
920311482 1:205051491-205051513 GAGAGTGGCAAGGACAGGGAGGG + Intronic
920777988 1:208959078-208959100 TAGAGTGGCCAGGATGTGGGAGG - Intergenic
921293542 1:213681017-213681039 CAGACAGACCAGGATGTGGATGG + Intergenic
922889400 1:229048595-229048617 CAGAGTGCCCAGCACATGAAAGG - Intergenic
923276791 1:232403511-232403533 CAGCATGGGCAGGACCTGGAAGG - Exonic
924037960 1:239955244-239955266 GAGAGTGGACAGGACTTGAATGG + Intergenic
924493035 1:244558735-244558757 CAGAGTGGGCAGGAGGAGAAGGG - Intronic
1065054058 10:21825448-21825470 CACAGTAGCCAAGAGGTGGAAGG - Intronic
1065493654 10:26307669-26307691 GAGAGTGGGCAGGATGGGGAAGG - Intergenic
1068055193 10:52004668-52004690 CAGAGTGACCTGGAAGTGGTAGG + Intronic
1069032909 10:63617054-63617076 CAGTGTGGCAAGGAAGGGGATGG - Intronic
1070441668 10:76452109-76452131 CAGTGTGGACAGGAAGTGGGTGG + Intronic
1071521676 10:86335254-86335276 CAGAGTGCCCAGCACCTGGGAGG - Intronic
1071906408 10:90179297-90179319 CAGAGAGGTCAGAATGTGGAAGG + Intergenic
1072249371 10:93569436-93569458 CTAAGTGGCCAAGACATGGAAGG - Intronic
1073060970 10:100733430-100733452 CAGAGGGGCCATGAAGAGGAAGG - Intergenic
1073321041 10:102616464-102616486 CAGAATGAACAGGACCTGGAGGG + Intronic
1073441991 10:103557586-103557608 CAGAGGGGACAGGAGTTGGAAGG + Intronic
1076882199 10:133245072-133245094 CACAGGGGCCAGGACGGGGCTGG - Intergenic
1076909606 10:133380301-133380323 GAGATTGGCCAGCACGTGGCCGG + Exonic
1077308465 11:1878203-1878225 CAGAGTGTTGAGGAGGTGGAGGG - Intronic
1077501475 11:2911484-2911506 CAGGGTGGCCAGGGTGAGGAAGG + Intronic
1079274977 11:19027003-19027025 AAGTGTGGCAAGGAGGTGGAGGG + Intergenic
1080616512 11:33949233-33949255 GGGAGTGGGCAGGACATGGAGGG + Intergenic
1082013794 11:47469348-47469370 TTGAGTGGCCAGGGCCTGGATGG - Intronic
1084660566 11:70544235-70544257 CAGAGTGGGCAGGCCGGGGCTGG - Intronic
1084769426 11:71333197-71333219 CAGAGTGGCCAGTCCTTGGCTGG + Intergenic
1085645389 11:78219164-78219186 CAGAGTAGAGAGGAGGTGGATGG + Exonic
1085907220 11:80778060-80778082 CACAGTAGCCAGGACATGGTAGG - Intergenic
1089294422 11:117459266-117459288 CAGAGTGGCTTGGACCTGGATGG + Intronic
1093321219 12:17717987-17718009 CTGAGCTGCCAGGACTTGGAGGG + Intergenic
1099928411 12:89045889-89045911 CAGATTGCCCAGGACTTGGGGGG + Intergenic
1101937482 12:109069962-109069984 CAGGGAGGCCAGGGCGGGGAGGG + Intronic
1102001642 12:109561257-109561279 CAGAGTGGGCAGGGCTGGGAGGG + Intronic
1102352708 12:112206175-112206197 CACAGTGCCCAGGACGTTGTGGG + Intronic
1102571487 12:113829627-113829649 CAGGGTGGACAGGACGAGGTGGG + Intronic
1103832721 12:123793148-123793170 CAGAGTGGCCTGGCTGTGCAAGG + Intronic
1104904977 12:132208293-132208315 TAGTGTGGCCAGGAAGGGGAGGG - Intronic
1107377747 13:39822717-39822739 CAGAGAGGCAAGAACGAGGAAGG - Intergenic
1109258411 13:60112557-60112579 CAGAGGGGCCAGGAGGGGGTGGG - Intronic
1115791155 14:36880056-36880078 CTGAGTGGCCAGGAAGAAGAGGG - Intronic
1118090082 14:62464773-62464795 CTGAGTGACCAATACGTGGAAGG - Intergenic
1118377727 14:65191599-65191621 AGGAGTTGCCAGGACCTGGAGGG + Intergenic
1119886966 14:78151540-78151562 CAGAGCTGCCAGGGCTTGGAAGG - Intergenic
1122079218 14:99255436-99255458 CAGGGGGGCCAGGGGGTGGAAGG + Intronic
1122919746 14:104875106-104875128 CAGGGTGGCCTGCACGTGGCAGG + Intronic
1124170460 15:27368053-27368075 CAGAATGGCCAGGAATGGGACGG + Intronic
1124372367 15:29110977-29110999 CCGAGTGGCCAGGAAGCTGAGGG + Intronic
1124379375 15:29151797-29151819 GATAGTGGACAGGACGTTGAGGG + Exonic
1124624544 15:31300477-31300499 CAGAGATGCCAGGTCGCGGAGGG + Intergenic
1124720115 15:32104430-32104452 CAGAGTGGGCTGGAGGTGGAGGG - Intronic
1127693248 15:61418595-61418617 CAGAGTTGGCAGCACGTTGAAGG + Intergenic
1128377348 15:67086755-67086777 CTGTGTGGCCAGGACATAGAAGG - Intronic
1129542753 15:76364333-76364355 CAAAGTGTCAAGGACGAGGAGGG + Intronic
1130138086 15:81198208-81198230 AAGAGTGGCCAGGAAATGGTTGG - Intronic
1132209074 15:100007232-100007254 CACAATGTCCAGGAGGTGGAGGG + Intronic
1132336964 15:101053875-101053897 CAGAGTGGCCAGAGGGTGAAAGG + Intronic
1132700214 16:1219063-1219085 CCGAGGGGACAGGGCGTGGAGGG - Exonic
1132712118 16:1273578-1273600 CGGAGGGGCCAGGACGAGGAAGG + Intergenic
1132734435 16:1378558-1378580 CAGAGTGCGCAGCATGTGGAGGG + Intronic
1134202888 16:12213598-12213620 GAGAGTGTCCAGGCTGTGGAAGG + Intronic
1135292727 16:21254064-21254086 AAGAGGGGCCAGGAGGTGGTAGG - Intronic
1135303617 16:21350839-21350861 CAGAGTGTCCAGGAAGGGGCAGG + Intergenic
1136300363 16:29330034-29330056 CAGAGTGTCCAGGAAGGGGCAGG + Intergenic
1136342957 16:29656871-29656893 CCGGGTGGCAAGGGCGTGGATGG + Intergenic
1136403472 16:30030655-30030677 CAAAGGGGCCAGGGCGGGGACGG + Exonic
1136999270 16:35215189-35215211 GAGTGTGGCCTGGAAGTGGAAGG - Intergenic
1137003681 16:35252946-35252968 GAGTGTGGCCTGGATGTGGAAGG + Intergenic
1137569619 16:49557143-49557165 GAGAGTGACCAGGGCGTGCAGGG + Intronic
1137915041 16:52420850-52420872 CAGAGTGGGCAGGATGTGGGGGG - Intergenic
1138339684 16:56280567-56280589 CAGAGTGGACAGGGCAGGGAGGG + Intronic
1138411919 16:56847140-56847162 CAGAAGGGCCAGGACTCGGATGG + Intronic
1138512543 16:57516865-57516887 CAGAGTGGCTGGGAAGAGGAAGG + Intronic
1138533183 16:57646142-57646164 TTGAGTGGACAGGACCTGGACGG - Intronic
1139181658 16:64755412-64755434 CAGAGTGGCCAGGACATTGCAGG + Intergenic
1141000728 16:80305026-80305048 CACAGTGGTCATGAGGTGGAAGG - Intergenic
1141039515 16:80660966-80660988 CTGAGAGGGCAGGAAGTGGAGGG + Intronic
1141191178 16:81825777-81825799 CAGAGTCTCCAGCATGTGGAGGG - Intronic
1141883993 16:86879352-86879374 CAGAAAGGCCCGGAAGTGGACGG + Intergenic
1142714015 17:1738211-1738233 CACACTGGCCAGGGCCTGGATGG - Exonic
1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG + Intronic
1144062889 17:11599048-11599070 CAGAGGGGCGAGGCTGTGGAGGG + Intronic
1144495436 17:15742342-15742364 CAGAGGGGCCTGGAAGTGGGAGG + Intronic
1144638789 17:16926539-16926561 CAGAGGGGCCTGGAAGTGGGAGG - Intergenic
1147807777 17:43144370-43144392 GAGAGGGGCCAGGAGGTGGTAGG + Intergenic
1148687287 17:49507990-49508012 CAGAGATGGCAGGACTTGGAAGG - Intronic
1149662043 17:58339102-58339124 CAGAGAGGCCGGGAGATGGAGGG - Intergenic
1150444368 17:65217175-65217197 CAGGGTGGCTGGGAAGTGGAAGG - Intronic
1152624477 17:81381960-81381982 CACAATGGCCTGGACATGGAGGG + Intergenic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1152677892 17:81651027-81651049 CACAGTGGGCAGGAGGGGGAGGG + Exonic
1152930289 17:83105780-83105802 CCGAGTGGCCAGCACGGGCAGGG + Intergenic
1153045037 18:848193-848215 CAGAGTGGAGAGGAAGTAGAAGG - Intergenic
1153474356 18:5481633-5481655 CAGAGTGTCCAGGACTGGGGTGG - Intronic
1153806461 18:8712435-8712457 CAGTGTGGCCTGGGGGTGGAGGG + Intronic
1153813143 18:8769671-8769693 CAGCCTGGCCAGCAAGTGGAAGG - Intronic
1156041229 18:32825234-32825256 CAGAGTATCCAGGAAGTGGCTGG - Intergenic
1160165075 18:76503957-76503979 CAGCGTGTGCAGGACCTGGACGG + Intergenic
1160423776 18:78766949-78766971 CAGAGTGGGGAGGACGCTGAAGG - Intergenic
1160623526 18:80187609-80187631 CAGGGGAGCCAGGAGGTGGATGG - Intronic
1161048551 19:2150359-2150381 CAGAGTGGCCACCACGTGTCTGG - Intronic
1161262432 19:3345330-3345352 CAGGGAGGACAGGCCGTGGAGGG - Intergenic
1161567109 19:5009412-5009434 CAGTGGGGCCTGGAAGTGGAAGG + Intronic
1162495031 19:11018771-11018793 GAGACTGGCGAGGACGTGAAGGG - Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163130692 19:15271005-15271027 GAGAGTGGCCAGGACGTTCTTGG - Intronic
1163595979 19:18221164-18221186 CAGACTGGCCAGGACCTGTTGGG + Exonic
1164447629 19:28331420-28331442 CAGAGTGGCCAGGAAAAGAAGGG + Intergenic
1164598911 19:29548183-29548205 CTCCGTGTCCAGGACGTGGAAGG - Intronic
1164611566 19:29636200-29636222 CAGAGAGGCCAGGAAGTGAGGGG - Intergenic
1164901580 19:31930595-31930617 GAGATTGGCAAGGAGGTGGAAGG - Intergenic
1165396867 19:35569267-35569289 CAGAGTCGTCAGGACTGGGATGG - Intergenic
1165471356 19:36006597-36006619 CGGACTGGCCAGGACCTGGTGGG - Exonic
1165792425 19:38500225-38500247 CAGAGTGGTCAGGGCTGGGATGG + Intronic
1166200139 19:41232098-41232120 CAGAGTGGCCAGGGCTGGGATGG - Intronic
1166317542 19:41997557-41997579 CAGAGTGGGCGGGAGGGGGATGG - Intergenic
1166645788 19:44530715-44530737 CAGAGTGGGCAGGGCTGGGATGG + Intergenic
1166658020 19:44626504-44626526 CAGAGTGGGCAGGGCTGGGATGG + Intronic
1166704780 19:44902766-44902788 CAGAGTGGGCAGGACTAGGTTGG + Intronic
1167008789 19:46792638-46792660 CAGAGTGGGCAGGGCTGGGATGG + Intergenic
1167018425 19:46856906-46856928 CAAGGTGGCCAGGGCTTGGACGG + Intergenic
1167246015 19:48373668-48373690 CTGTGTGTCCAGGACGAGGAAGG - Exonic
1167948888 19:53010721-53010743 CAGAGGGGACAGGCCGTGCAGGG - Intergenic
1167959098 19:53091504-53091526 CAGAGAGGCCAGGAGTTGGGAGG + Exonic
1168567911 19:57440123-57440145 GAGAGTGGCCATGAGATGGATGG + Intronic
925562464 2:5211637-5211659 CAGGGTGGCCAGGCCTTGGCGGG - Intergenic
926731424 2:16038681-16038703 CAAAGTGGCCTGGACATGGTAGG - Intergenic
929856714 2:45643700-45643722 TAGACCGGCCAGGACGTAGAAGG + Intergenic
932085278 2:68752162-68752184 TAGAGATGTCAGGACGTGGAGGG - Intronic
932331620 2:70901234-70901256 CCGCGGGGACAGGACGTGGAGGG + Intronic
932813493 2:74843605-74843627 CTGAGTGGGCAGGAGGTGGGTGG - Intronic
937039217 2:118807998-118808020 CAGAGTGGGCAGGAGGGAGAGGG + Intergenic
937152324 2:119694583-119694605 CAAAGGGGCCAGGAGGAGGATGG - Intergenic
938411622 2:131069581-131069603 GAGAATGGCCAGAACCTGGAAGG - Intronic
942133669 2:172904966-172904988 CACAGGGGCCAGGACAGGGAAGG - Intronic
942525730 2:176850584-176850606 CAGAGTGGGCTGGAGGTGGAAGG + Intergenic
945067862 2:205962191-205962213 CAGGGTGGCCAGTCAGTGGATGG - Intergenic
949038565 2:241833501-241833523 CATAATGGCCAAAACGTGGAGGG + Intergenic
1171121655 20:22573600-22573622 AAGAGAGGGCAGGACGTGGATGG + Intergenic
1172669480 20:36625047-36625069 CAGAGTGTCCAGCATGTGGTGGG - Intronic
1174271042 20:49368769-49368791 CAGAGTGGGCAGGAGGGAGAAGG - Exonic
1174395694 20:50245646-50245668 CAGTGTGGCCAGGCTGTGGGAGG + Intergenic
1174399289 20:50267372-50267394 CAGAGTGCCCAGCATGTGGTAGG - Intergenic
1174737959 20:52983877-52983899 CAGAGTTGCCAGGTCCTGGGGGG - Intronic
1175038862 20:56026699-56026721 CAGAGTCGCCACGAAGTGGCAGG + Intergenic
1175252383 20:57617213-57617235 CAGACAGGCCAGCACTTGGAGGG - Intronic
1176051224 20:63120698-63120720 GGGAGGGGCCAGGACCTGGAGGG - Intergenic
1176268567 20:64223493-64223515 CAGAGGGGCAGGGCCGTGGAGGG + Intronic
1176676650 21:9784767-9784789 AAGAGTGGTGAGGAGGTGGAGGG + Intergenic
1180782720 22:18529840-18529862 CAGAGTGGCCGGGAACTGTAAGG + Intronic
1181126280 22:20703867-20703889 CAGAGTGGCCGGGAACTGTAAGG + Intergenic
1181239610 22:21469178-21469200 CAGAGTGGCCGGGAACTGTAAGG + Intergenic
1181477827 22:23179811-23179833 CAGAGAGGCCAGGACCAGGCAGG - Intronic
1182143803 22:27984461-27984483 CAGAGTGACAAGGATGAGGAGGG - Intronic
1182487234 22:30646826-30646848 GAGGTTGCCCAGGACGTGGACGG - Exonic
1182517462 22:30867170-30867192 CAGAGAGGCCAGGAAGGGGTGGG - Intronic
1183259268 22:36783808-36783830 CAGAGTGTGCAGGACATGGAGGG - Intergenic
1183494609 22:38135483-38135505 CAGTGTGGTAAGGAGGTGGAGGG - Intronic
1184908219 22:47506782-47506804 CAGAGTGGCCAGGACAAAGCAGG + Intergenic
1185100419 22:48837716-48837738 GAGTGTGGCCAGGACGCGGTGGG - Intronic
951445948 3:22781003-22781025 CAGAGAGGCCAGAAACTGGAAGG + Intergenic
953741525 3:45542990-45543012 CAGAGGGGCCAGGGCCTGGCTGG - Intronic
953813328 3:46132870-46132892 TAGAGAGGCCAGGTGGTGGAGGG + Intergenic
953878682 3:46680585-46680607 CAGAGTGCCCAGGAGGTACATGG - Intronic
953879567 3:46684609-46684631 CAGAATGGGGAGGACGTGGGAGG + Intronic
954436443 3:50498807-50498829 CAGTGGGCCCAGGAAGTGGAGGG - Intronic
955491512 3:59487815-59487837 CAGAGTGGCCAGGAGTCAGAGGG - Intergenic
955638420 3:61055515-61055537 CAGAGGGGCTAGCACGTGGTTGG - Intronic
961371872 3:126436176-126436198 CAGAGTGGCCTGGAGGTGACTGG + Intronic
961797849 3:129422575-129422597 AAGAGTGCCCAGGGTGTGGATGG - Intronic
962196037 3:133364597-133364619 TAGAGTGACCAGAACCTGGAAGG + Intronic
962856515 3:139350876-139350898 CAGAGTGGCCAGTATGTGGGTGG + Intronic
962887785 3:139643434-139643456 CACAGTAGCCAGAAGGTGGAAGG + Intronic
963908254 3:150792012-150792034 CAGAGGTGCCAGGACCTTGATGG + Intergenic
964060652 3:152518311-152518333 CAGAGTTGCCAGGAGGAGCAGGG - Intergenic
964925528 3:161951944-161951966 CAGAGAAGCCAGGACTTGGAAGG + Intergenic
965722603 3:171678069-171678091 CAGAGTGGGAAGGGCGGGGAGGG + Intronic
968555729 4:1245630-1245652 CAGAGTGGCATGGACGGGCAGGG + Intronic
969182413 4:5452264-5452286 CAGAGAGGCCAGCGAGTGGAGGG + Intronic
969365196 4:6690125-6690147 CAGAGAGGCCAGGAGGAGGGCGG - Intergenic
970962729 4:21891559-21891581 GAGTGAGGCCAGGACTTGGAGGG + Intronic
972833714 4:42843321-42843343 CAGAGAGGACAGGAGGTGGAGGG - Intergenic
975668311 4:76755121-76755143 CAGTGTGGGGAGGAGGTGGAGGG - Exonic
975844388 4:78509499-78509521 CAAAATGGCCAGGACATCGATGG + Intronic
976775996 4:88706779-88706801 CAGACTGGCCATGCCGTAGATGG - Exonic
978351590 4:107825266-107825288 CGGAGGGGCCAGGAGGAGGATGG + Intronic
978417238 4:108489317-108489339 CAGTGTGGAAAGGACGTGGCTGG - Intergenic
978607830 4:110501704-110501726 CACAGTAGCAAAGACGTGGATGG - Intronic
982600609 4:157443938-157443960 CAGAGGGGCAAGGACCTGCATGG + Intergenic
982771847 4:159403645-159403667 CAGAGAGGCCAGGGTGTTGATGG - Intergenic
983580589 4:169306014-169306036 CAGAGGGGACAGGATGTGAAGGG - Intergenic
984526631 4:180866243-180866265 CAGAGTGGCAAGGGGGTGGCGGG + Intergenic
985398887 4:189574001-189574023 AAGAGTGGTGAGGAGGTGGAGGG - Intergenic
985850047 5:2382175-2382197 CAGACTGGCCAGGCTGTGGGTGG - Intergenic
988784664 5:34555429-34555451 CACAGTGGCCAGTTAGTGGAGGG + Intergenic
989371848 5:40718610-40718632 CTGAGTAGCCACCACGTGGAGGG - Intronic
989772905 5:45166216-45166238 GTGACTGGCCAGGATGTGGAAGG - Intergenic
990569506 5:57063926-57063948 CAGGGTGGCCAAGAGGTGAAGGG + Intergenic
992152087 5:73914824-73914846 CAGTGAGTCCAGGAGGTGGATGG - Intronic
996658009 5:125964927-125964949 CAGATGGGCTAGGACCTGGAAGG + Intergenic
997864100 5:137445438-137445460 CTGAGTGCCCAGCACATGGAAGG - Intronic
998477092 5:142431304-142431326 CACAGTGCCCAGCACGTGGGAGG - Intergenic
998994123 5:147851902-147851924 CACAGTCGCAAGGACCTGGAAGG + Intergenic
1000204777 5:159048404-159048426 CAGAGTTGGCATGCCGTGGAAGG - Intronic
1000494764 5:161967975-161967997 CAGTGTGGCAAGAACGAGGATGG - Intergenic
1001182012 5:169529299-169529321 CAGAGAGGGCAGGAGGTAGAAGG - Intergenic
1001450668 5:171821987-171822009 CAGAGTGGCTAGGAGGTGCCTGG + Intergenic
1002284805 5:178154904-178154926 CAGAGCTGCCAGGGCGTGGGGGG + Intergenic
1002468961 5:179423252-179423274 CAGAGTGGCCAGGTCGGTGAAGG + Intergenic
1002493936 5:179599268-179599290 CAGAGTGGGCAGCTGGTGGAGGG + Intronic
1002598294 5:180338556-180338578 CAGAGTCCCCCGGACGAGGAAGG - Exonic
1003788793 6:9518464-9518486 CAGAGGGGCTGGGAAGTGGAGGG + Intergenic
1003967181 6:11264077-11264099 CAGAGTTCCCCGGATGTGGAAGG + Intronic
1005589298 6:27308804-27308826 AAGAGTGGACAGGAAGGGGAAGG + Intronic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1007377854 6:41468691-41468713 CAGAGTCCCCAGGAAGTGGAGGG - Intergenic
1007402312 6:41610180-41610202 CAGAGAGGACAGCACGTGAAGGG + Intergenic
1012858730 6:104533587-104533609 GAGAGGGGCCAGGACAGGGATGG - Intergenic
1013297182 6:108768141-108768163 CACAGTGGGCAGGAAGTGGCTGG - Intergenic
1017825861 6:158081481-158081503 CTCAGTGTCCTGGACGTGGACGG + Exonic
1018613195 6:165662638-165662660 CCGAGTGGCCTGGCCGTGGCCGG - Intronic
1019485665 7:1288159-1288181 CAGAGTCCCCAGGACGTCCAGGG + Intergenic
1019505247 7:1387282-1387304 CAGTTTGGCCAGGACAGGGAGGG + Intergenic
1019564082 7:1671004-1671026 CAGAGGGACGAGGACGAGGATGG - Intergenic
1019566226 7:1680352-1680374 CAGGATGGTCAAGACGTGGATGG + Intergenic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1022342955 7:29486020-29486042 CAGGCTGGGCAGGAGGTGGAAGG - Intronic
1023864748 7:44233386-44233408 CAGAGCAGCCAGGCCGTGGCTGG - Intronic
1024628423 7:51228157-51228179 CAGCGTGGCCACGTCGTGGCTGG - Intronic
1025025367 7:55512334-55512356 GAGAGTCGCCTGGACCTGGAAGG + Intronic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1031753776 7:125612361-125612383 CAGCGTGGCTAGGACATGGAAGG + Intergenic
1032012653 7:128356954-128356976 CAGAGTGGTCAGGGAGTGGAGGG + Intronic
1032724519 7:134578246-134578268 CAAAGTGGACAGGAAGTGGTAGG + Intronic
1034948477 7:155280055-155280077 ATGAGTGACCAGGTCGTGGAGGG - Intergenic
1035337352 7:158138434-158138456 CTGAGTGGCCTGGAGCTGGACGG - Exonic
1038264056 8:26023361-26023383 CAGATTTGCTAGGAAGTGGATGG - Intronic
1038632826 8:29262624-29262646 CTGAGGGGCCAGGACGAGGCTGG + Intronic
1039178794 8:34839937-34839959 CAGAGAGGCCAGGATGAGGGAGG - Intergenic
1039419420 8:37423585-37423607 CACAGATGCCAGGACATGGAAGG - Intergenic
1040741521 8:50580950-50580972 CACATGGGCCAGGATGTGGAAGG + Intronic
1048583114 8:135746984-135747006 CAGAGTGCCCAGGACTGGAAAGG + Intergenic
1048872727 8:138812553-138812575 CAGGGAGGTCAGGACATGGATGG - Intronic
1049324830 8:142016451-142016473 CAGAGAGGCCTGGAGGAGGACGG - Intergenic
1049408160 8:142460803-142460825 GAGAGTGCTCAGGAGGTGGAAGG - Intronic
1049616915 8:143579551-143579573 GGGAGTGGCCAGGAGATGGAGGG + Intergenic
1050104178 9:2148313-2148335 CAGAGTGGCCTAGACAAGGAAGG + Intronic
1051463641 9:17352979-17353001 CAGAGTAGCCAAAATGTGGAAGG - Intronic
1052786146 9:32830469-32830491 CAGTGTGGCCAGGAAGTTCAGGG + Intergenic
1052812808 9:33076475-33076497 CCGAGAGGCCAGGGAGTGGAGGG - Intronic
1053466624 9:38313174-38313196 CTGAATGCCCAGGACGGGGAAGG + Intergenic
1055023530 9:71695166-71695188 CAGAGTGGCAAGGAAGAGGGTGG - Intronic
1056225629 9:84492537-84492559 CAGAGCTGCCTGGACTTGGAGGG - Intergenic
1056928396 9:90854154-90854176 CAGACTGGCCGGGTGGTGGAGGG + Intronic
1057310433 9:93939608-93939630 GAGAGGGGCCAGGACATAGATGG + Intergenic
1057740671 9:97708772-97708794 CTATGTGGCCAGGACGGGGAGGG + Intergenic
1058425435 9:104871492-104871514 CACACTGGCCAGGGCGTGGAAGG + Intronic
1058899599 9:109430787-109430809 GAGAGGGGCCAGGTCATGGAGGG - Intronic
1060019834 9:120119750-120119772 CAGAATGGCCAAGACATGCAAGG - Intergenic
1060765420 9:126292121-126292143 CAGTGGGGCCAGACCGTGGAAGG - Intergenic
1061571837 9:131482582-131482604 CACAGTGGCCAGGGCCTGGGTGG + Intronic
1061979167 9:134090258-134090280 CACAGAGGCCAGGAAGTGGCAGG + Intergenic
1062237982 9:135521775-135521797 CAGAGTGGGCAGGGCTGGGAGGG + Intronic
1062270074 9:135704294-135704316 CAGAGGGGCCAGGAGGTGCTTGG + Intronic
1062281206 9:135752553-135752575 CACAGCGTCCAGGACATGGATGG + Intronic
1062460285 9:136660060-136660082 CAGAGCGGCCAGGGCAGGGAAGG + Intronic
1190569643 X:51768334-51768356 CAGTGAGGCCAGGAGGTGGTGGG + Intergenic
1191861091 X:65667391-65667413 CTGGAAGGCCAGGACGTGGAAGG + Intronic
1195205954 X:102600415-102600437 CAGAGTGGGCAGTACTTGGGAGG + Exonic
1196337187 X:114551031-114551053 CAGAGTCTCCAAGATGTGGAGGG + Intergenic
1199951399 X:152708834-152708856 CAAAGAGGCGAGGAAGTGGAAGG - Intergenic
1199958284 X:152759627-152759649 CAAAGAGGCGAGGAAGTGGAAGG + Intergenic