ID: 901669434

View in Genome Browser
Species Human (GRCh38)
Location 1:10847004-10847026
Sequence CATCAGATGGAGACCCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901669434_901669441 20 Left 901669434 1:10847004-10847026 CCTTCTGGGGTCTCCATCTGATG No data
Right 901669441 1:10847047-10847069 TCCACTCTGGCCACAGAGAGAGG No data
901669434_901669443 21 Left 901669434 1:10847004-10847026 CCTTCTGGGGTCTCCATCTGATG No data
Right 901669443 1:10847048-10847070 CCACTCTGGCCACAGAGAGAGGG No data
901669434_901669440 7 Left 901669434 1:10847004-10847026 CCTTCTGGGGTCTCCATCTGATG No data
Right 901669440 1:10847034-10847056 GAGTACAGCTCTCTCCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901669434 Original CRISPR CATCAGATGGAGACCCCAGA AGG (reversed) Intergenic
No off target data available for this crispr