ID: 901669434 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:10847004-10847026 |
Sequence | CATCAGATGGAGACCCCAGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
901669434_901669441 | 20 | Left | 901669434 | 1:10847004-10847026 | CCTTCTGGGGTCTCCATCTGATG | No data | ||
Right | 901669441 | 1:10847047-10847069 | TCCACTCTGGCCACAGAGAGAGG | No data | ||||
901669434_901669443 | 21 | Left | 901669434 | 1:10847004-10847026 | CCTTCTGGGGTCTCCATCTGATG | No data | ||
Right | 901669443 | 1:10847048-10847070 | CCACTCTGGCCACAGAGAGAGGG | No data | ||||
901669434_901669440 | 7 | Left | 901669434 | 1:10847004-10847026 | CCTTCTGGGGTCTCCATCTGATG | No data | ||
Right | 901669440 | 1:10847034-10847056 | GAGTACAGCTCTCTCCACTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
901669434 | Original CRISPR | CATCAGATGGAGACCCCAGA AGG (reversed) | Intergenic | ||
No off target data available for this crispr |