ID: 901669440

View in Genome Browser
Species Human (GRCh38)
Location 1:10847034-10847056
Sequence GAGTACAGCTCTCTCCACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901669426_901669440 27 Left 901669426 1:10846984-10847006 CCCCACTACCAAGGCAATGCCCT No data
Right 901669440 1:10847034-10847056 GAGTACAGCTCTCTCCACTCTGG No data
901669432_901669440 19 Left 901669432 1:10846992-10847014 CCAAGGCAATGCCCTTCTGGGGT No data
Right 901669440 1:10847034-10847056 GAGTACAGCTCTCTCCACTCTGG No data
901669434_901669440 7 Left 901669434 1:10847004-10847026 CCTTCTGGGGTCTCCATCTGATG No data
Right 901669440 1:10847034-10847056 GAGTACAGCTCTCTCCACTCTGG No data
901669433_901669440 8 Left 901669433 1:10847003-10847025 CCCTTCTGGGGTCTCCATCTGAT No data
Right 901669440 1:10847034-10847056 GAGTACAGCTCTCTCCACTCTGG No data
901669427_901669440 26 Left 901669427 1:10846985-10847007 CCCACTACCAAGGCAATGCCCTT No data
Right 901669440 1:10847034-10847056 GAGTACAGCTCTCTCCACTCTGG No data
901669428_901669440 25 Left 901669428 1:10846986-10847008 CCACTACCAAGGCAATGCCCTTC No data
Right 901669440 1:10847034-10847056 GAGTACAGCTCTCTCCACTCTGG No data
901669436_901669440 -6 Left 901669436 1:10847017-10847039 CCATCTGATGCCCCACGGAGTAC No data
Right 901669440 1:10847034-10847056 GAGTACAGCTCTCTCCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901669440 Original CRISPR GAGTACAGCTCTCTCCACTC TGG Intergenic
No off target data available for this crispr