ID: 901669443

View in Genome Browser
Species Human (GRCh38)
Location 1:10847048-10847070
Sequence CCACTCTGGCCACAGAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901669436_901669443 8 Left 901669436 1:10847017-10847039 CCATCTGATGCCCCACGGAGTAC No data
Right 901669443 1:10847048-10847070 CCACTCTGGCCACAGAGAGAGGG No data
901669433_901669443 22 Left 901669433 1:10847003-10847025 CCCTTCTGGGGTCTCCATCTGAT No data
Right 901669443 1:10847048-10847070 CCACTCTGGCCACAGAGAGAGGG No data
901669439_901669443 -4 Left 901669439 1:10847029-10847051 CCACGGAGTACAGCTCTCTCCAC No data
Right 901669443 1:10847048-10847070 CCACTCTGGCCACAGAGAGAGGG No data
901669437_901669443 -2 Left 901669437 1:10847027-10847049 CCCCACGGAGTACAGCTCTCTCC No data
Right 901669443 1:10847048-10847070 CCACTCTGGCCACAGAGAGAGGG No data
901669438_901669443 -3 Left 901669438 1:10847028-10847050 CCCACGGAGTACAGCTCTCTCCA No data
Right 901669443 1:10847048-10847070 CCACTCTGGCCACAGAGAGAGGG No data
901669434_901669443 21 Left 901669434 1:10847004-10847026 CCTTCTGGGGTCTCCATCTGATG No data
Right 901669443 1:10847048-10847070 CCACTCTGGCCACAGAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901669443 Original CRISPR CCACTCTGGCCACAGAGAGA GGG Intergenic
No off target data available for this crispr