ID: 901669859

View in Genome Browser
Species Human (GRCh38)
Location 1:10849835-10849857
Sequence ATAGGGAAGTGGACAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901669848_901669859 -5 Left 901669848 1:10849817-10849839 CCCTCCCCACCTTTCACCATAGG No data
Right 901669859 1:10849835-10849857 ATAGGGAAGTGGACAGTGGAAGG No data
901669850_901669859 -6 Left 901669850 1:10849818-10849840 CCTCCCCACCTTTCACCATAGGG No data
Right 901669859 1:10849835-10849857 ATAGGGAAGTGGACAGTGGAAGG No data
901669847_901669859 8 Left 901669847 1:10849804-10849826 CCAGGGCACAGGGCCCTCCCCAC No data
Right 901669859 1:10849835-10849857 ATAGGGAAGTGGACAGTGGAAGG No data
901669846_901669859 9 Left 901669846 1:10849803-10849825 CCCAGGGCACAGGGCCCTCCCCA No data
Right 901669859 1:10849835-10849857 ATAGGGAAGTGGACAGTGGAAGG No data
901669852_901669859 -9 Left 901669852 1:10849821-10849843 CCCCACCTTTCACCATAGGGAAG No data
Right 901669859 1:10849835-10849857 ATAGGGAAGTGGACAGTGGAAGG No data
901669844_901669859 16 Left 901669844 1:10849796-10849818 CCCAGAGCCCAGGGCACAGGGCC No data
Right 901669859 1:10849835-10849857 ATAGGGAAGTGGACAGTGGAAGG No data
901669853_901669859 -10 Left 901669853 1:10849822-10849844 CCCACCTTTCACCATAGGGAAGT No data
Right 901669859 1:10849835-10849857 ATAGGGAAGTGGACAGTGGAAGG No data
901669845_901669859 15 Left 901669845 1:10849797-10849819 CCAGAGCCCAGGGCACAGGGCCC No data
Right 901669859 1:10849835-10849857 ATAGGGAAGTGGACAGTGGAAGG No data
901669840_901669859 25 Left 901669840 1:10849787-10849809 CCTGGGACTCCCAGAGCCCAGGG No data
Right 901669859 1:10849835-10849857 ATAGGGAAGTGGACAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901669859 Original CRISPR ATAGGGAAGTGGACAGTGGA AGG Intergenic
No off target data available for this crispr