ID: 901669888

View in Genome Browser
Species Human (GRCh38)
Location 1:10849983-10850005
Sequence TGCCCCAGCAGGACACCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901669874_901669888 29 Left 901669874 1:10849931-10849953 CCTGGGCGGCCATCCCTAAAAGA No data
Right 901669888 1:10849983-10850005 TGCCCCAGCAGGACACCCCAGGG No data
901669879_901669888 15 Left 901669879 1:10849945-10849967 CCTAAAAGAAGGGAAACAAACAA 0: 2
1: 3
2: 25
3: 231
4: 1802
Right 901669888 1:10849983-10850005 TGCCCCAGCAGGACACCCCAGGG No data
901669877_901669888 20 Left 901669877 1:10849940-10849962 CCATCCCTAAAAGAAGGGAAACA No data
Right 901669888 1:10849983-10850005 TGCCCCAGCAGGACACCCCAGGG No data
901669878_901669888 16 Left 901669878 1:10849944-10849966 CCCTAAAAGAAGGGAAACAAACA 0: 2
1: 2
2: 21
3: 174
4: 1296
Right 901669888 1:10849983-10850005 TGCCCCAGCAGGACACCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901669888 Original CRISPR TGCCCCAGCAGGACACCCCA GGG Intergenic
No off target data available for this crispr