ID: 901672564

View in Genome Browser
Species Human (GRCh38)
Location 1:10864797-10864819
Sequence TTACAGAAACACAAGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901672554_901672564 11 Left 901672554 1:10864763-10864785 CCATCACCTCCTCCCTCCAGTCC No data
Right 901672564 1:10864797-10864819 TTACAGAAACACAAGGAGCTAGG No data
901672557_901672564 -1 Left 901672557 1:10864775-10864797 CCCTCCAGTCCCCATTTCTTATT No data
Right 901672564 1:10864797-10864819 TTACAGAAACACAAGGAGCTAGG No data
901672560_901672564 -10 Left 901672560 1:10864784-10864806 CCCCATTTCTTATTTACAGAAAC No data
Right 901672564 1:10864797-10864819 TTACAGAAACACAAGGAGCTAGG No data
901672555_901672564 5 Left 901672555 1:10864769-10864791 CCTCCTCCCTCCAGTCCCCATTT No data
Right 901672564 1:10864797-10864819 TTACAGAAACACAAGGAGCTAGG No data
901672556_901672564 2 Left 901672556 1:10864772-10864794 CCTCCCTCCAGTCCCCATTTCTT No data
Right 901672564 1:10864797-10864819 TTACAGAAACACAAGGAGCTAGG No data
901672558_901672564 -2 Left 901672558 1:10864776-10864798 CCTCCAGTCCCCATTTCTTATTT No data
Right 901672564 1:10864797-10864819 TTACAGAAACACAAGGAGCTAGG No data
901672559_901672564 -5 Left 901672559 1:10864779-10864801 CCAGTCCCCATTTCTTATTTACA No data
Right 901672564 1:10864797-10864819 TTACAGAAACACAAGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901672564 Original CRISPR TTACAGAAACACAAGGAGCT AGG Intergenic
No off target data available for this crispr