ID: 901673424

View in Genome Browser
Species Human (GRCh38)
Location 1:10868914-10868936
Sequence TGCATGGGCCAGAAGAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901673412_901673424 26 Left 901673412 1:10868865-10868887 CCTTCATCTGTAAACTGGAAATA No data
Right 901673424 1:10868914-10868936 TGCATGGGCCAGAAGAGAGGAGG No data
901673418_901673424 -6 Left 901673418 1:10868897-10868919 CCTGTGTCCCAGGGGGGTGCATG No data
Right 901673424 1:10868914-10868936 TGCATGGGCCAGAAGAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901673424 Original CRISPR TGCATGGGCCAGAAGAGAGG AGG Intergenic
No off target data available for this crispr