ID: 901673807

View in Genome Browser
Species Human (GRCh38)
Location 1:10871192-10871214
Sequence GACCCGGAACTGTCCTCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901673807_901673810 25 Left 901673807 1:10871192-10871214 CCTACAGAGGACAGTTCCGGGTC No data
Right 901673810 1:10871240-10871262 TTCTTTTCTTTTTTCTGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901673807 Original CRISPR GACCCGGAACTGTCCTCTGT AGG (reversed) Intergenic