ID: 901678051

View in Genome Browser
Species Human (GRCh38)
Location 1:10898321-10898343
Sequence GGGTCAGAGGGCCCCCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901678034_901678051 20 Left 901678034 1:10898278-10898300 CCACACCAGCCACATCCTCTAAC No data
Right 901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG No data
901678038_901678051 15 Left 901678038 1:10898283-10898305 CCAGCCACATCCTCTAACGGGGT No data
Right 901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG No data
901678041_901678051 5 Left 901678041 1:10898293-10898315 CCTCTAACGGGGTGACCAGGAGT No data
Right 901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG No data
901678039_901678051 11 Left 901678039 1:10898287-10898309 CCACATCCTCTAACGGGGTGACC No data
Right 901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG No data
901678045_901678051 -10 Left 901678045 1:10898308-10898330 CCAGGAGTCCCAGGGGTCAGAGG No data
Right 901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901678051 Original CRISPR GGGTCAGAGGGCCCCCTCAA GGG Intergenic
No off target data available for this crispr