ID: 901679026

View in Genome Browser
Species Human (GRCh38)
Location 1:10902501-10902523
Sequence CCTGTGGGACCCCCGTCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901679026_901679035 26 Left 901679026 1:10902501-10902523 CCAGAAGACGGGGGTCCCACAGG No data
Right 901679035 1:10902550-10902572 GCAGCCAGTAGCTTCCATGAAGG No data
901679026_901679029 -10 Left 901679026 1:10902501-10902523 CCAGAAGACGGGGGTCCCACAGG No data
Right 901679029 1:10902514-10902536 GTCCCACAGGTCTCAGGCTCTGG No data
901679026_901679030 -9 Left 901679026 1:10902501-10902523 CCAGAAGACGGGGGTCCCACAGG No data
Right 901679030 1:10902515-10902537 TCCCACAGGTCTCAGGCTCTGGG No data
901679026_901679033 4 Left 901679026 1:10902501-10902523 CCAGAAGACGGGGGTCCCACAGG No data
Right 901679033 1:10902528-10902550 AGGCTCTGGGCTGTGCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901679026 Original CRISPR CCTGTGGGACCCCCGTCTTC TGG (reversed) Intergenic
No off target data available for this crispr