ID: 901679031

View in Genome Browser
Species Human (GRCh38)
Location 1:10902516-10902538
Sequence GCCCAGAGCCTGAGACCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901679031_901679035 11 Left 901679031 1:10902516-10902538 CCCACAGGTCTCAGGCTCTGGGC No data
Right 901679035 1:10902550-10902572 GCAGCCAGTAGCTTCCATGAAGG No data
901679031_901679037 17 Left 901679031 1:10902516-10902538 CCCACAGGTCTCAGGCTCTGGGC No data
Right 901679037 1:10902556-10902578 AGTAGCTTCCATGAAGGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901679031 Original CRISPR GCCCAGAGCCTGAGACCTGT GGG (reversed) Intergenic
No off target data available for this crispr