ID: 901679032

View in Genome Browser
Species Human (GRCh38)
Location 1:10902517-10902539
Sequence AGCCCAGAGCCTGAGACCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901679032_901679037 16 Left 901679032 1:10902517-10902539 CCACAGGTCTCAGGCTCTGGGCT No data
Right 901679037 1:10902556-10902578 AGTAGCTTCCATGAAGGCAAAGG No data
901679032_901679035 10 Left 901679032 1:10902517-10902539 CCACAGGTCTCAGGCTCTGGGCT No data
Right 901679035 1:10902550-10902572 GCAGCCAGTAGCTTCCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901679032 Original CRISPR AGCCCAGAGCCTGAGACCTG TGG (reversed) Intergenic
No off target data available for this crispr