ID: 901679037

View in Genome Browser
Species Human (GRCh38)
Location 1:10902556-10902578
Sequence AGTAGCTTCCATGAAGGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901679031_901679037 17 Left 901679031 1:10902516-10902538 CCCACAGGTCTCAGGCTCTGGGC No data
Right 901679037 1:10902556-10902578 AGTAGCTTCCATGAAGGCAAAGG No data
901679032_901679037 16 Left 901679032 1:10902517-10902539 CCACAGGTCTCAGGCTCTGGGCT No data
Right 901679037 1:10902556-10902578 AGTAGCTTCCATGAAGGCAAAGG No data
901679034_901679037 -10 Left 901679034 1:10902543-10902565 CCTTCTGGCAGCCAGTAGCTTCC No data
Right 901679037 1:10902556-10902578 AGTAGCTTCCATGAAGGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901679037 Original CRISPR AGTAGCTTCCATGAAGGCAA AGG Intergenic
No off target data available for this crispr