ID: 901679775

View in Genome Browser
Species Human (GRCh38)
Location 1:10906287-10906309
Sequence CTGGGCACCCACTTGGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901679775_901679779 -9 Left 901679775 1:10906287-10906309 CCTGGCACCAAGTGGGTGCCCAG No data
Right 901679779 1:10906301-10906323 GGTGCCCAGGGCAGAAAGCTTGG No data
901679775_901679780 -8 Left 901679775 1:10906287-10906309 CCTGGCACCAAGTGGGTGCCCAG No data
Right 901679780 1:10906302-10906324 GTGCCCAGGGCAGAAAGCTTGGG No data
901679775_901679786 30 Left 901679775 1:10906287-10906309 CCTGGCACCAAGTGGGTGCCCAG No data
Right 901679786 1:10906340-10906362 CAACCCTCCTGCCCCGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901679775 Original CRISPR CTGGGCACCCACTTGGTGCC AGG (reversed) Intergenic
No off target data available for this crispr