ID: 901680715

View in Genome Browser
Species Human (GRCh38)
Location 1:10911233-10911255
Sequence CACTCAGAGCAGAGGAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901680713_901680715 -9 Left 901680713 1:10911219-10911241 CCTGTGTGCACACACACTCAGAG No data
Right 901680715 1:10911233-10911255 CACTCAGAGCAGAGGAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901680715 Original CRISPR CACTCAGAGCAGAGGAACAC AGG Intergenic
No off target data available for this crispr