ID: 901686084

View in Genome Browser
Species Human (GRCh38)
Location 1:10944352-10944374
Sequence CGCACGGGTGTTGCCTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901686084_901686094 9 Left 901686084 1:10944352-10944374 CCAGCAGAGGCAACACCCGTGCG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 901686094 1:10944384-10944406 AGCAGGCATGGGTGCCAGCCAGG 0: 1
1: 0
2: 3
3: 38
4: 365
901686084_901686095 19 Left 901686084 1:10944352-10944374 CCAGCAGAGGCAACACCCGTGCG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 901686095 1:10944394-10944416 GGTGCCAGCCAGGTCTGCCCTGG 0: 1
1: 0
2: 2
3: 35
4: 304
901686084_901686091 -2 Left 901686084 1:10944352-10944374 CCAGCAGAGGCAACACCCGTGCG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 901686091 1:10944373-10944395 CGTGTCCCGGGAGCAGGCATGGG 0: 1
1: 0
2: 0
3: 8
4: 117
901686084_901686088 -8 Left 901686084 1:10944352-10944374 CCAGCAGAGGCAACACCCGTGCG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 901686088 1:10944367-10944389 CCCGTGCGTGTCCCGGGAGCAGG 0: 1
1: 0
2: 2
3: 15
4: 102
901686084_901686090 -3 Left 901686084 1:10944352-10944374 CCAGCAGAGGCAACACCCGTGCG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 901686090 1:10944372-10944394 GCGTGTCCCGGGAGCAGGCATGG 0: 1
1: 0
2: 0
3: 23
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901686084 Original CRISPR CGCACGGGTGTTGCCTCTGC TGG (reversed) Intergenic
901686084 1:10944352-10944374 CGCACGGGTGTTGCCTCTGCTGG - Intergenic
904582168 1:31552512-31552534 CACACGTCTGGTGCCTCTGCTGG + Intergenic
904644581 1:31956225-31956247 CGCAGGGCAGTTCCCTCTGCTGG + Intergenic
908792355 1:67795367-67795389 CGCACGCACCTTGCCTCTGCAGG + Intronic
915016316 1:152737526-152737548 GGCACTGCTGTTGGCTCTGCTGG - Intronic
1067363321 10:45601514-45601536 CCCAAGGGGGTTGCCACTGCTGG - Intergenic
1068813296 10:61280957-61280979 CCCACTGGTGGTGCCTCTGGTGG - Intergenic
1074436612 10:113439805-113439827 CCCTCAGGAGTTGCCTCTGCTGG + Intergenic
1077541214 11:3147339-3147361 GGCACGGCTCCTGCCTCTGCTGG + Intronic
1079837726 11:25355227-25355249 CACACAGTTGTTGCCTTTGCAGG - Intergenic
1083756279 11:64793394-64793416 CACAGGGCTGTTGCCTCTGCTGG - Intronic
1096973304 12:55684392-55684414 CGCATGGGTGTAGCCTCAGGAGG - Exonic
1104898158 12:132174216-132174238 CGCCTGGGCTTTGCCTCTGCTGG + Intergenic
1105009341 12:132745031-132745053 TGCCCGGGAGCTGCCTCTGCTGG - Intronic
1106303836 13:28494048-28494070 CACCCGGGTGGGGCCTCTGCCGG - Intronic
1106436654 13:29729417-29729439 AAAAGGGGTGTTGCCTCTGCTGG + Intergenic
1113773915 13:112931447-112931469 AACACGGGTGTAGCCTCTCCTGG - Intronic
1113881749 13:113630885-113630907 CACACTGGCGTTGCCTCTGGTGG + Intronic
1202851597 14_GL000225v1_random:23582-23604 CCCGCGGGTGCTGCCTCAGCTGG - Intergenic
1129447173 15:75626442-75626464 TGCCAGGGTGTAGCCTCTGCAGG + Intronic
1129774912 15:78230235-78230257 CCCACGGGTTTTGCCTCTCCTGG + Intronic
1133394838 16:5438609-5438631 CACACGGGTTTCACCTCTGCTGG + Intergenic
1134689420 16:16181508-16181530 TGCACTGCTGTTCCCTCTGCTGG - Intronic
1141877287 16:86834582-86834604 TGAACGGGTGTTGCCTCCTCAGG + Intergenic
1142528181 17:559894-559916 GGAAAGGGTGATGCCTCTGCTGG - Intronic
1145794543 17:27647974-27647996 GGCACGGGTGTGGCCTGTCCAGG + Intronic
1147996719 17:44363663-44363685 CGCGCGGCTGTTGCCGCTGCTGG - Exonic
1150135556 17:62693085-62693107 GGCACGGGTGTGGTGTCTGCTGG + Exonic
1151573840 17:74941395-74941417 GGCATGGGTGTAGCCTCAGCAGG - Intronic
1151830119 17:76544561-76544583 CGCTCTGGCTTTGCCTCTGCAGG - Intronic
1152595136 17:81234199-81234221 TGCTCAGGTGTGGCCTCTGCAGG - Intronic
1153957687 18:10112134-10112156 CACAAGGCTGGTGCCTCTGCAGG - Intergenic
1160699568 19:499234-499256 TGCACGGCTGTGCCCTCTGCCGG + Intronic
1160709044 19:542353-542375 GGGACGGGAGCTGCCTCTGCAGG + Intergenic
1162261947 19:9541033-9541055 CCCAAGGGGGTTGCCACTGCTGG + Intergenic
931471766 2:62545379-62545401 TTCACGGGTGTTCCCACTGCAGG + Intergenic
940666565 2:156617568-156617590 CCCAAGGGGGTTGCCACTGCTGG + Intergenic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
945513709 2:210735146-210735168 CCCAAGTGGGTTGCCTCTGCTGG - Intergenic
946440619 2:219692181-219692203 CCCAAGGGGGTTGCCTCTGGAGG + Intergenic
948423467 2:237874382-237874404 CGCACGGGGACTGGCTCTGCAGG + Intronic
948765925 2:240218792-240218814 GCCAAGGGTGTTTCCTCTGCGGG - Intergenic
949037438 2:241822318-241822340 CGCAAGGCTGGTTCCTCTGCAGG - Intergenic
1170373985 20:15679791-15679813 CCCAAGTGTGGTGCCTCTGCTGG - Intronic
1170515794 20:17129203-17129225 CGCAGGCCTGTGGCCTCTGCAGG - Intergenic
1171484305 20:25476458-25476480 AGCCCGGGAGCTGCCTCTGCTGG - Exonic
1172510398 20:35496960-35496982 CACACGGGTGTAGCCCATGCAGG + Intronic
1173875246 20:46366398-46366420 GGCACAGGTGTGGCCTCAGCCGG + Exonic
1182922157 22:34090043-34090065 TGCATGGGTGCTGTCTCTGCAGG - Intergenic
1183565645 22:38612631-38612653 GGCAGGGGTGGTGCATCTGCAGG - Intronic
1184192124 22:42901855-42901877 CGCCCTGGTGGTGCCCCTGCAGG - Intronic
1184909185 22:47514751-47514773 CCCAAGGCTGCTGCCTCTGCTGG + Intergenic
952902935 3:38121621-38121643 CCCACAGGTGGTGCCCCTGCGGG + Exonic
960101203 3:113745728-113745750 CCCCCGGGTCTTGCCTCCGCTGG + Intronic
961012924 3:123448156-123448178 CGCCCGGGTGCTGCCCCCGCTGG + Exonic
965609556 3:170530298-170530320 AGAGCGGGTGTTGCATCTGCTGG + Intronic
969867573 4:10085660-10085682 CCCACGGGTGTTCCTTCTGGAGG + Intronic
970385138 4:15548411-15548433 CTCATGGGTGTTCCCTGTGCTGG - Intronic
974641615 4:64640009-64640031 CCCAAGGGGGTTGCCACTGCTGG + Intergenic
975754991 4:77562947-77562969 CCCATGGGGGTTGCCACTGCTGG - Intronic
977626952 4:99197915-99197937 GGGAGGGGTGTTGCCGCTGCTGG + Intergenic
984662402 4:182387512-182387534 CCCAAGCGTGTTGCCACTGCTGG - Intronic
985531754 5:437726-437748 CACGTGGGTGTTGGCTCTGCCGG + Exonic
987761200 5:22164620-22164642 CCCAAGGGGGTTGCCTTTGCTGG + Intronic
989292450 5:39785528-39785550 CCCAAGGGGGTTGCCACTGCTGG + Intergenic
995582864 5:113619160-113619182 CCCAAGGGGGTTGCCACTGCTGG + Intergenic
996204917 5:120721554-120721576 CTCAAGGGTGTTGCCTCTTTAGG - Intergenic
1003799988 6:9653148-9653170 CGCAAGGGGGTTGCCGCTGCTGG + Intronic
1005712142 6:28512620-28512642 CCCACGGGGGCTGCCACTGCTGG - Intronic
1007663223 6:43499128-43499150 CTCAGGGGCCTTGCCTCTGCCGG - Intronic
1008780598 6:55099227-55099249 CACACGGTTTTTGCCTCTGGGGG + Intergenic
1013395599 6:109735910-109735932 TGCATAGGTCTTGCCTCTGCAGG + Intronic
1014837165 6:126172673-126172695 CTCACAGCTGTTACCTCTGCAGG + Intergenic
1016577297 6:145583975-145583997 CACACAGTTGCTGCCTCTGCTGG - Intronic
1019351579 7:556568-556590 CTCACGGGTGGGGCCCCTGCCGG - Intronic
1021434849 7:20602403-20602425 ATCTAGGGTGTTGCCTCTGCAGG - Intergenic
1022483677 7:30760974-30760996 CACACAGGTGTTCCCTCTGCTGG - Intronic
1022498248 7:30866536-30866558 CACACTGGTCTTGCCTCTCCAGG - Intronic
1024054104 7:45648513-45648535 CGCAAGGGTGTGGCCTGGGCGGG + Intronic
1031540305 7:122987518-122987540 CGCAAGGATGTGGCCTCAGCTGG + Intergenic
1032248197 7:130230806-130230828 CCCAAGCGTGTTGCCACTGCTGG - Intergenic
1042919263 8:73906323-73906345 CCCAAGTGTGTTGCCACTGCTGG - Intergenic
1049944026 9:577171-577193 CCCAAGCGGGTTGCCTCTGCTGG + Intronic
1051459221 9:17294238-17294260 CCCAAGGGGGTTGCCACTGCTGG + Intronic
1057208540 9:93187091-93187113 CCCTCAGGTGCTGCCTCTGCAGG + Intronic
1060722873 9:125990065-125990087 CGCATGGGTGTTGCCGGTGGAGG - Intergenic
1062069451 9:134547718-134547740 CCCCCGCCTGTTGCCTCTGCTGG + Intergenic
1197782923 X:130174740-130174762 AGCAAGGGTGTGGCCTCTTCTGG + Intronic
1201176906 Y:11315139-11315161 CCCACCGGTGCTGCCTCAGCTGG - Intergenic