ID: 901687233

View in Genome Browser
Species Human (GRCh38)
Location 1:10949683-10949705
Sequence CTGGTCCTGCAGCCCACACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 292}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901687231_901687233 -9 Left 901687231 1:10949669-10949691 CCATTCCTGGGCAGCTGGTCCTG 0: 1
1: 0
2: 6
3: 35
4: 334
Right 901687233 1:10949683-10949705 CTGGTCCTGCAGCCCACACCTGG 0: 1
1: 0
2: 4
3: 39
4: 292
901687225_901687233 15 Left 901687225 1:10949645-10949667 CCGGTGCAGGAGGTCCCGAGAAA 0: 1
1: 0
2: 0
3: 6
4: 78
Right 901687233 1:10949683-10949705 CTGGTCCTGCAGCCCACACCTGG 0: 1
1: 0
2: 4
3: 39
4: 292
901687228_901687233 1 Left 901687228 1:10949659-10949681 CCCGAGAAAGCCATTCCTGGGCA 0: 1
1: 0
2: 2
3: 16
4: 236
Right 901687233 1:10949683-10949705 CTGGTCCTGCAGCCCACACCTGG 0: 1
1: 0
2: 4
3: 39
4: 292
901687229_901687233 0 Left 901687229 1:10949660-10949682 CCGAGAAAGCCATTCCTGGGCAG 0: 1
1: 0
2: 3
3: 29
4: 235
Right 901687233 1:10949683-10949705 CTGGTCCTGCAGCCCACACCTGG 0: 1
1: 0
2: 4
3: 39
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901687233 Original CRISPR CTGGTCCTGCAGCCCACACC TGG Exonic
900401892 1:2476117-2476139 CTTGTCCCGCAGCCCTGACCTGG + Intronic
900412110 1:2517271-2517293 TGGGTCCTGCAGTTCACACCAGG - Intronic
900624033 1:3600082-3600104 CTGGCGCTGCAGCCCAGGCCGGG - Intronic
901028761 1:6293887-6293909 CTGCTACTGCAGAACACACCTGG - Intronic
901494235 1:9612316-9612338 CTGGGGCTGCAGCCTGCACCGGG + Intronic
901512261 1:9723287-9723309 CTGGGCCTGAAACCCACCCCGGG - Exonic
901551831 1:10001206-10001228 CTGATCCTGCAGCTCCCACCCGG + Intronic
901687233 1:10949683-10949705 CTGGTCCTGCAGCCCACACCTGG + Exonic
902044486 1:13514327-13514349 CTGGCCCTGCAGGCCACAGCGGG - Intergenic
902311869 1:15587208-15587230 CTGAACTTGCAGCCCACCCCAGG - Intronic
902625511 1:17673961-17673983 CTGATTCTGAAGCCCCCACCTGG + Intronic
902650296 1:17832922-17832944 CTGGGACTGCAACCCCCACCTGG + Intergenic
903499446 1:23793372-23793394 CTGGTGCTGGACCCCACTCCTGG - Intronic
903605241 1:24570746-24570768 CTGGTGATGCAGACCACACATGG + Intronic
903825815 1:26145180-26145202 CTGGTCTTGCTGCGCACACCTGG - Intergenic
904687967 1:32274335-32274357 CTGTGGCTGCAGCTCACACCCGG + Exonic
904747640 1:32720784-32720806 CTGGTCCTGGAGCCTACCCCTGG + Intergenic
904987232 1:34561959-34561981 CTGGCACTGCAGCCCACAGATGG + Intergenic
905210455 1:36370369-36370391 CAGGTCCTCCAGGCCACTCCAGG + Intronic
906550662 1:46663841-46663863 AGGCTTCTGCAGCCCACACCTGG + Intronic
908253827 1:62286262-62286284 CCGGCCCTGCAGCCGAAACCTGG - Intronic
908966263 1:69767970-69767992 GTCTTCCTGCAGCCCTCACCTGG - Intronic
908987732 1:70045224-70045246 CTGGTCCTGCAGTATAGACCGGG - Intronic
910136603 1:83979322-83979344 CTGGTCCTGTGGCCTCCACCCGG - Intronic
912550741 1:110483735-110483757 CTTGACCTCCAGCCCTCACCTGG - Intergenic
915038708 1:152949663-152949685 CTGCACCTGCATCCCACACTTGG - Intergenic
915142603 1:153776570-153776592 CTGGGCCTGCAGCCCACAGGTGG - Exonic
915473036 1:156137109-156137131 CAGCTCCTGCAGCCCAGATCTGG - Exonic
918371596 1:183866924-183866946 CTTGTCCTGCCACCAACACCTGG - Intronic
919819766 1:201465692-201465714 CTGGGCCTAAAGCCCACTCCTGG - Exonic
920251342 1:204624378-204624400 CTGTCCCTGAAGCCCACAGCTGG - Intronic
920326450 1:205168724-205168746 CTGCTTCTGAAGCCCACATCAGG - Intronic
922160546 1:223076617-223076639 CTGGCACTGCAGGCCACCCCAGG + Intergenic
1066954092 10:42149280-42149302 CTGGTGCTGGAGCCCAACCCTGG + Intergenic
1067696303 10:48537875-48537897 CTGTTCCTGCTGTCCACTCCTGG - Intronic
1067787928 10:49264476-49264498 CTGGTCCTGCTTGCCACACATGG - Intergenic
1069620803 10:69836264-69836286 CTGGGACTGTAGCCCACACTGGG - Intronic
1069781813 10:70961622-70961644 CTGGCTCTGCAGCCCACCCCAGG - Intergenic
1073200003 10:101727623-101727645 CTGGTCTTGCAGCCCAGGTCAGG - Intergenic
1073302444 10:102479390-102479412 CTGCTGCTGTGGCCCACACCTGG + Exonic
1075722155 10:124593521-124593543 CGGGTCATGCAGCCAACACACGG - Intronic
1075988165 10:126806499-126806521 CTGGCACTGCAGCGCACACCTGG + Intergenic
1076140962 10:128078242-128078264 CTGGTCCTGCAGCCTCAGCCTGG + Intronic
1076403932 10:130200349-130200371 CTGGTCCTGCAGTGCCCACAGGG - Intergenic
1076485615 10:130814750-130814772 CTGGCCCTGGAGCCAACTCCAGG - Intergenic
1076553543 10:131304946-131304968 CTCCTCCAGCAGCCCACACTTGG + Intronic
1076859519 10:133133996-133134018 CTGGCCCTGCAGCCCCCAGGAGG - Intergenic
1077050363 11:563649-563671 ATGGTCTTGCAGCCCTCACTAGG - Exonic
1077089361 11:771462-771484 CAGGCCCTGCGGCCCACCCCAGG + Intronic
1077393988 11:2312274-2312296 CTGGGCCTCCAGTCCTCACCAGG + Intronic
1077671972 11:4165765-4165787 CTAAACCTGCAGCCCACCCCAGG + Intergenic
1077701423 11:4445489-4445511 GTGCTCCTGCTGCCCACACCTGG - Intergenic
1078053684 11:7989110-7989132 CCGGTCCTCCATCCCATACCCGG + Intronic
1078538366 11:12193307-12193329 CTGTTCCTGCAGCCCAGAGCTGG - Intronic
1080250410 11:30227278-30227300 CTGGTCGTGTGGCCTACACCCGG - Intergenic
1080867925 11:36212122-36212144 CTGCTCCTGCAGGCCACATCTGG - Intronic
1082243302 11:49892470-49892492 CCGGTCCTCCAGGCCACACACGG + Intergenic
1083151444 11:60794205-60794227 AGGGCCCAGCAGCCCACACCTGG - Intronic
1084513966 11:69625718-69625740 CTGCTCCTGCAGGGTACACCTGG - Intergenic
1084653714 11:70503325-70503347 CTGGCACTGCAGCCCAGCCCTGG - Intronic
1086131598 11:83407509-83407531 CTTGACCTGCAGCCCACCACAGG + Intergenic
1086287180 11:85263529-85263551 CTTGACCTTCAGCCTACACCAGG + Intronic
1091599433 12:1908917-1908939 AGGTTCCTGCACCCCACACCCGG + Intronic
1091930565 12:4392298-4392320 CTTGTCACGCAGCCCACATCAGG + Intergenic
1094045102 12:26158702-26158724 CTGCTCCTGCAGCAGACCCCTGG + Intronic
1094167173 12:27454723-27454745 CTGGCCCTCCACCCCACAACGGG + Intergenic
1095472741 12:42553737-42553759 CTGGTTCTGCTGCTTACACCAGG + Intronic
1096216742 12:49801962-49801984 CAGGTCCTGCCGCCCACCCCGGG + Exonic
1096774802 12:53957293-53957315 CTGATCCCGCTGCCCGCACCGGG + Exonic
1099289732 12:80761841-80761863 CAGGTCCCCCAGCCCCCACCTGG - Intergenic
1099843471 12:87997560-87997582 CTGGCCCTCCACCCCACAACAGG + Intronic
1103680650 12:122690899-122690921 CTGGTCCTTAAGCCCAAGCCTGG + Intergenic
1105405198 13:20127714-20127736 CTGGCCCTGCTGCCCACTCGGGG - Intergenic
1105854579 13:24362402-24362424 CAGGCCCTACTGCCCACACCCGG + Intergenic
1107468304 13:40667835-40667857 CTGGACCTGCAGCCCAGATGAGG - Intergenic
1108151252 13:47537053-47537075 CTAGCCCTGCACCCCACAACAGG - Intergenic
1108465159 13:50707791-50707813 CTGGTCCAGCAGACCAGACTAGG + Intronic
1108808251 13:54186642-54186664 CTGCCCCTCCAGCCCCCACCAGG + Intergenic
1111313774 13:86524147-86524169 TTGGTCCTGCAACCCACAAATGG - Intergenic
1111887237 13:94037690-94037712 CTGGTACTGAAGCCAAAACCTGG - Intronic
1113544754 13:111139644-111139666 CTGCTCCTGCAGCCCACATCAGG - Intronic
1113783209 13:112988368-112988390 CGGGCCCTGCTCCCCACACCGGG - Intronic
1113826724 13:113261239-113261261 CTTATCCTGCATCCCACACGTGG - Intronic
1117412758 14:55465869-55465891 CTGGCCCTGGAGCTCCCACCAGG + Intergenic
1117948013 14:61051251-61051273 TTGGCACTGCAGCCCACACAGGG - Intronic
1118979905 14:70707869-70707891 CTGGTTCTGCAACACACACTGGG + Intergenic
1121421028 14:93814379-93814401 CTGGTCCTATGGCCCCCACCTGG - Intergenic
1122550045 14:102544715-102544737 CAGGTCCTCCAGCCCCGACCCGG - Intergenic
1122606365 14:102949274-102949296 CTGCTCCTGCAGCTGACACTGGG + Intronic
1122623072 14:103070724-103070746 CCGGTCCTGGAGACCCCACCAGG + Intergenic
1122772048 14:104101893-104101915 CTGAGCCTGCAGGCCTCACCTGG + Intronic
1122956485 14:105073844-105073866 CAGGTTCTGCAGCCCACCCTGGG + Intergenic
1123019554 14:105391285-105391307 GTGCTCCTGCAGCCCACCCACGG - Intronic
1123058009 14:105581539-105581561 AAGGACCTGCACCCCACACCAGG - Intergenic
1124157323 15:27237411-27237433 CTGATCCTGCAGCCCAGGACTGG - Intronic
1124378205 15:29141863-29141885 CTGGTCCTGCCGCCACCCCCAGG + Intronic
1127530498 15:59839001-59839023 CTGCTCCTACAGCCCACTTCTGG - Intergenic
1127930549 15:63594289-63594311 CTGTTCCTGCAGCCAAGGCCTGG + Intronic
1128225460 15:65998392-65998414 CTGCTCCTCCTGCCCTCACCTGG - Intronic
1128723840 15:69973380-69973402 ATGCTCCTGTAGCACACACCAGG + Intergenic
1129323878 15:74789454-74789476 CTGGTTCTGCAGAGGACACCAGG - Intronic
1130305979 15:82712243-82712265 CTGCTCCTGAAGGCAACACCAGG + Intergenic
1132098661 15:99007118-99007140 AGAGGCCTGCAGCCCACACCAGG - Intronic
1133026811 16:2992168-2992190 GTGGTCCAGCTGCCCTCACCTGG - Intergenic
1135279856 16:21144976-21144998 CTGGGACTACAGGCCACACCTGG - Intronic
1136054536 16:27678634-27678656 CTGGTTCTCCAACCCACACGGGG + Intronic
1136711624 16:32241468-32241490 CTGCTCCTGCAGCCCCCACTGGG - Intergenic
1136756292 16:32687938-32687960 CTGCTCCTGCAGCCCCCACTGGG + Intergenic
1136768333 16:32810988-32811010 CTGCTCCTGGAGCCCAGCCCGGG + Intergenic
1136811821 16:33182437-33182459 CTGCTCCTGCAGCCCCCACTGGG - Intergenic
1136818297 16:33292517-33292539 CTGCTCCTGCAGCCCCCACTGGG - Intronic
1136824861 16:33349050-33349072 CTGCTCCTGCAGCCCCCACTGGG - Intergenic
1136829927 16:33447821-33447843 CTGCTCCTGCAGCCCCCACTGGG - Intergenic
1136996753 16:35195867-35195889 CTGGACCTGCAGCCCCCACTGGG - Intergenic
1137028202 16:35499105-35499127 CTGGACCTGCAGCCTTCACTGGG - Intergenic
1137028584 16:35501573-35501595 CTGCTCCTGCAGCCTGCACAGGG - Intergenic
1138597764 16:58038280-58038302 CTGGTCTGGCACCCCACAGCGGG - Exonic
1139684380 16:68591253-68591275 CTGCTCCTGCATCCCACCACGGG - Intergenic
1141730068 16:85816324-85816346 CTGGTCCTCCAGGACACACACGG + Intergenic
1141997613 16:87645411-87645433 CTGGACCTGCCACCCCCACCTGG - Intronic
1142004530 16:87683162-87683184 GTGGTCCCGCAACCCACACCGGG + Intronic
1142197292 16:88744766-88744788 CTGGGCCTGGAGGCCACTCCTGG + Intronic
1142292363 16:89198984-89199006 CTGGGCCAGCAGCCCTCATCGGG - Intronic
1142363946 16:89640034-89640056 CTGGTTCTGCTGCCCACAGTGGG - Intergenic
1202990399 16_KI270728v1_random:5405-5427 CTGCTCCTGCAGCCCCCACTGGG - Intergenic
1203058430 16_KI270728v1_random:948291-948313 CTGCTCCTGCAGCCCCCACTGGG + Intergenic
1203070725 16_KI270728v1_random:1073004-1073026 CTGCTCCTGGAGCCCAGCCCGGG + Intergenic
1142488202 17:260309-260331 CTGGTACAGCACGCCACACCTGG + Intronic
1143090422 17:4446521-4446543 CAGGCCCTGCACCCCACAACAGG + Intronic
1143536209 17:7541527-7541549 TTGGGCCTGTAGCTCACACCTGG - Intergenic
1143576131 17:7794366-7794388 CTCGTCCTGCAGCCCCCATGAGG - Intronic
1144093733 17:11881340-11881362 CTGGTCCTCCAGGCCATCCCTGG - Exonic
1146206631 17:30910501-30910523 ATGGTCCTGCAGTCCAACCCCGG + Intronic
1147758088 17:42781300-42781322 CCGCACCTGCAGCTCACACCAGG - Exonic
1147969683 17:44212686-44212708 CTGTCCATGCAGCCCACCCCTGG + Intronic
1148155676 17:45424190-45424212 AGGGTCCTGCAGGCCTCACCCGG + Intronic
1149972741 17:61235254-61235276 CCGGTCCTTCAGCCTTCACCTGG - Intronic
1151490405 17:74429740-74429762 TGGGTCCAGCAGCCCCCACCAGG + Intronic
1151605166 17:75131220-75131242 CTGGACCTGGAGCCCATCCCGGG - Exonic
1151674989 17:75592662-75592684 CTGGCCCTGCAGAGCACAGCAGG - Intergenic
1151826069 17:76525139-76525161 CTTCTCCTGCAGCCCACCCGGGG + Intergenic
1152244925 17:79180489-79180511 GAGGACCTGCAGCCCCCACCTGG + Intronic
1152465517 17:80464159-80464181 CTGCTCCAGGAGCCCACAGCTGG + Intergenic
1152536200 17:80951526-80951548 CTGGTGCCCCAGCCCACAGCTGG - Intronic
1152566798 17:81103860-81103882 CTGTTGCTGGAGCCCACCCCGGG - Intronic
1152599972 17:81257370-81257392 CCGGTACAGCAGCTCACACCTGG - Intronic
1152660985 17:81541832-81541854 CCAGTGCTGCAGCCCACACTGGG - Intronic
1152931819 17:83113904-83113926 CTGGTCCTGCGGACCGCAGCAGG - Intergenic
1152934544 17:83128430-83128452 CTGGTTCTGCAGACTACACCCGG + Intergenic
1153571501 18:6477818-6477840 CTGATCCTGGAGCCTATACCTGG + Intergenic
1154311909 18:13273566-13273588 TGGGTCCGGCAGCTCACACCTGG - Intronic
1156172012 18:34496591-34496613 CCACTCCTGCACCCCACACCTGG - Intronic
1156395494 18:36695959-36695981 TTGGTCCTGCACCAAACACCTGG + Intronic
1157248342 18:46072412-46072434 CAGGGGCTGCAGCCCGCACCCGG + Intergenic
1157284985 18:46371581-46371603 CTGGGCATGAAGCCCCCACCTGG + Intronic
1157554917 18:48607185-48607207 CTGGGCCTGGAGGCCACTCCAGG + Intronic
1157807442 18:50668567-50668589 AGGCTCCTGCAGCCCACACTTGG + Intronic
1160190235 18:76709123-76709145 CTGGGCCTGGAGTCCACCCCAGG - Intergenic
1160862320 19:1242616-1242638 CTGGCCCTGCAGCCCTCCACCGG - Intronic
1161283245 19:3456772-3456794 CTGGGCCTCGAGCCCCCACCTGG + Intronic
1161326541 19:3667053-3667075 CTGCCCCTGCAGCCCTGACCAGG + Intronic
1161383164 19:3977181-3977203 CAGGCTCTGCAGGCCACACCGGG + Intronic
1161457167 19:4375220-4375242 CGGGCCCTCCAGCCCCCACCTGG + Intronic
1161740886 19:6020569-6020591 TCGGTGCTGGAGCCCACACCTGG + Intronic
1161936862 19:7377505-7377527 CAGGTGCAGCAGCTCACACCTGG + Intronic
1162438639 19:10679330-10679352 CTGCTCCTGCTTGCCACACCTGG + Intronic
1162742084 19:12779121-12779143 CTGGGCCAGCAGCCCCCAGCTGG + Intronic
1162818672 19:13210260-13210282 CTGGTCCTGCAGCTCCTACCTGG - Intronic
1162828714 19:13270689-13270711 CTGGGCCTGCAGCCCTGCCCTGG + Intronic
1163598032 19:18231761-18231783 CTGGCCCTGGAGCCTCCACCTGG + Intronic
1164597638 19:29540525-29540547 CCTGTCCTGCAGTCAACACCTGG + Intronic
1164768667 19:30791250-30791272 CTGGTCCTGGAGCCCACTTGGGG - Intergenic
1165066606 19:33232828-33232850 CCGGCCCTGCAGCCCGCCCCTGG + Intergenic
1165873726 19:38991236-38991258 CTGGTCCTGCAGAGGACGCCTGG + Intronic
1166196082 19:41206792-41206814 CTGGATCTGCAGCCCACACGTGG + Exonic
1166389346 19:42400419-42400441 CTGCTCCTGCTGACCACTCCAGG + Intergenic
1167510160 19:49891529-49891551 CCGGGCCTGGAGCCCACACTCGG + Intronic
1168147136 19:54426110-54426132 CTAGTCATGCAGCCCACTCGAGG + Intronic
1168450360 19:56461969-56461991 CTGCTACTGCAGGCCCCACCTGG + Intronic
926094640 2:10073224-10073246 CTGGACTGGCAGCCCACAGCCGG - Intronic
926428627 2:12763653-12763675 GTGGTCCTACATCCCACAGCTGG + Intergenic
927498079 2:23563992-23564014 CTGGACCTGCTGGCCACATCTGG + Intronic
927521915 2:23704048-23704070 CTGGTCCAGGAGCCCAACCCCGG + Intronic
927870496 2:26619954-26619976 CAGGACCTGAAGCCCACAGCGGG + Intronic
928085683 2:28345018-28345040 CTGGGACTCCAGCCCACACCAGG + Intergenic
929864821 2:45709096-45709118 CTGGCGCTGCTGCTCACACCTGG + Intronic
932620234 2:73260750-73260772 CAGGCCCTGCACCCCACAGCCGG + Exonic
932801463 2:74745928-74745950 CTGCAGGTGCAGCCCACACCAGG - Intergenic
934251515 2:90359769-90359791 CTGGTGCTGGAGCCCAGCCCTGG + Intergenic
934258044 2:91443629-91443651 CTGGTGCTGGAGCCCAGCCCTGG - Intergenic
936638066 2:114281925-114281947 CAGGTACTGCATCACACACCAGG - Intergenic
937308033 2:120884209-120884231 CTCTCCCTGCAGCCCACGCCTGG - Intronic
938381313 2:130837803-130837825 CTGGACCTGCAGCTGACAGCTGG - Intronic
938386349 2:130869944-130869966 CGGGTCCCGCTGGCCACACCGGG - Intronic
943443102 2:187950041-187950063 CCGGTCCTGTGGCCCGCACCTGG - Intergenic
945184619 2:207127104-207127126 GTGCTCCTGCAGTTCACACCAGG - Intronic
946495254 2:220190154-220190176 CTAGCCCTGCAGCCCCCAACAGG - Intergenic
946559561 2:220897591-220897613 CTGGTCATGGAGACCTCACCAGG + Intergenic
947249350 2:228083925-228083947 CTTGCCCTGCACCCCACAACAGG - Intronic
949076374 2:242061361-242061383 CTGGTACTGCACCACCCACCTGG - Intergenic
949076392 2:242061413-242061435 CTGGTACTGCACCCCCCATCTGG - Intergenic
1170561244 20:17560405-17560427 CTGGTGCAGCAGATCACACCAGG - Intronic
1170644805 20:18188228-18188250 CCAGTCCTGCAGACCACACAGGG - Exonic
1170723859 20:18908305-18908327 CCTGTCCTGCAGCCCTCACCTGG + Intergenic
1170894045 20:20398388-20398410 GTGGTCCAGCACACCACACCAGG - Intronic
1171280251 20:23890147-23890169 CTGTTCCTGCAGCTCTCCCCAGG + Intergenic
1171447210 20:25213338-25213360 CTGGTCCTCAAGGCCACAGCTGG + Exonic
1172101230 20:32484610-32484632 GTGCTCCGCCAGCCCACACCGGG + Intronic
1172650355 20:36497911-36497933 CTGGACCTGCAGACCAAACTAGG + Intronic
1173894022 20:46536771-46536793 CAGGACCTGCAGCTCACACTTGG + Intergenic
1173899284 20:46575492-46575514 CTGGTGCTGCAGCCAGCACTGGG + Intronic
1175237535 20:57525094-57525116 CGCGTGCTGCAGCCCACAGCCGG + Exonic
1175505749 20:59483029-59483051 CTGGGCCCGGAGCCTACACCTGG + Intergenic
1179988146 21:44932451-44932473 CTGGCCCCGCAGCCCCCGCCTGG - Intergenic
1180062476 21:45392776-45392798 CAGGCCCAGCAGCCCCCACCTGG - Intergenic
1180070188 21:45432036-45432058 CAGGGCCTGCAGCCCACAGCAGG - Intronic
1180857805 22:19059312-19059334 CCAGTCTTGCAGCCCCCACCGGG - Intronic
1181031962 22:20152620-20152642 CTCATCCTGCAGCCCAGCCCAGG - Intergenic
1181274673 22:21681036-21681058 CAGATCCTCCAGCCCACCCCTGG - Intronic
1181461729 22:23089714-23089736 CAGATCCTTCAGCCCACACATGG - Intronic
1181674289 22:24441713-24441735 CTGGTGCTGTGGCCCCCACCTGG - Exonic
1181858628 22:25800802-25800824 CAGGTCCTTGAGCCCACATCAGG - Intronic
1182033086 22:27175233-27175255 ATGGTAGTGCAGCCCACACTGGG + Intergenic
1182089451 22:27584037-27584059 CTGGTTCTGCAGGGCACCCCTGG - Intergenic
1182117485 22:27765554-27765576 CAGGCCATGCAGCCCACACGGGG - Intronic
1182650182 22:31845267-31845289 CAGGCCCTGCATCTCACACCAGG - Intronic
1182676283 22:32042306-32042328 CTGGCCCTGCAGCCCATGCCAGG - Intergenic
1182813098 22:33134646-33134668 CTGGACCTCCAGCACACCCCAGG + Intergenic
1183076551 22:35431039-35431061 CTGGCCCTGCAGGCCAGGCCGGG - Intergenic
1183394228 22:37562102-37562124 CTGCACCTGCACCCCACACCGGG + Intronic
1184437438 22:44487972-44487994 CTGGTCCTCCAGGGCACACAGGG + Intergenic
1185210296 22:49566900-49566922 CCGGGGCTGCAGCCCACACAAGG + Intronic
1185273068 22:49937497-49937519 CTGTCCCTGCAGCCCTCACTGGG + Intergenic
1185346091 22:50311446-50311468 CCAGTCCTGGAGCCCCCACCAGG - Exonic
950668051 3:14509185-14509207 CTGCCCCTGCAGCCCCCACCAGG + Intronic
952881118 3:37986874-37986896 CAGGTCCTGGAGCCCACTCCTGG - Intergenic
961537937 3:127581145-127581167 CTGGTGCCCCAGGCCACACCTGG - Intronic
961654083 3:128432186-128432208 GTGGTCCTGGAGCCCACTGCGGG + Intergenic
964969885 3:162547093-162547115 CTGTTCTTGCTGCCCCCACCTGG - Intergenic
967349294 3:188494283-188494305 CAGCTCCTGCAGCCCTCACCTGG - Intronic
967808620 3:193736662-193736684 CAGGGCCTGCACGCCACACCAGG - Intergenic
968931369 4:3581320-3581342 CAGTCCCTGCAGCCCAGACCTGG - Intronic
969224691 4:5787824-5787846 CTGGCTCTGCACCCCACTCCGGG + Intronic
971372502 4:26029804-26029826 CTGGGGCTGCAGCCCACTCGGGG - Intergenic
971698540 4:29937311-29937333 CTCATCCAGCACCCCACACCTGG - Intergenic
972158826 4:36198370-36198392 CTAGTCCTGCAGACCACAGTAGG - Intronic
974669371 4:65009202-65009224 CTGGACCTGTAGCCTAGACCCGG + Intergenic
974703970 4:65487616-65487638 TTGGTCTTGTAGCCCTCACCCGG + Intronic
975415523 4:74099846-74099868 CTGTTCCCGCACCCAACACCTGG - Intergenic
977714165 4:100162412-100162434 CTGGTCCTGCAGCCCCTGGCCGG - Intergenic
978524334 4:109649960-109649982 CTGCTCCTCCATACCACACCTGG - Intronic
981807349 4:148732156-148732178 CTGATACTGCAGGCCACAGCTGG - Intergenic
985100371 4:186452385-186452407 CTGGTCCTGTGACCCCCACCTGG - Intronic
985509544 5:305070-305092 CTGGAGCTGCAGCTCCCACCTGG - Intronic
985553089 5:543107-543129 CTGGCCCTGCAGCCCAGCCCTGG - Intergenic
985724702 5:1509913-1509935 CTCCTCCTGCAGGCCTCACCTGG - Intronic
989860678 5:46372006-46372028 CCGTTCCTCCAGCACACACCTGG + Intergenic
990469763 5:56104532-56104554 CTGGTGCTGCAGGCAACTCCAGG + Intronic
992186371 5:74248585-74248607 CTGGTCCTCCAGCCCACATCAGG - Intergenic
993671214 5:90764009-90764031 CCCTCCCTGCAGCCCACACCAGG - Intronic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
995798288 5:115963360-115963382 CTGGACCCGCAGCCTGCACCGGG - Intronic
996200959 5:120672417-120672439 CAGGTCCTGCCATCCACACCAGG - Intronic
996948072 5:129094366-129094388 CCGGTGCTGCAGCTCACACAAGG - Intergenic
998543675 5:143007065-143007087 CTGGGACTACAGGCCACACCTGG - Intronic
999268549 5:150282887-150282909 CTGCTCCTGCATCCCACAGCTGG - Intronic
1000359384 5:160433255-160433277 CTGGTTCTGCAGCCCTCAAAGGG - Intergenic
1001398596 5:171433518-171433540 GTGCTCCTGAGGCCCACACCTGG - Intronic
1001649508 5:173305370-173305392 TTGGTCCTAAAGCACACACCTGG - Intergenic
1006295293 6:33167473-33167495 CTGGGCCTGCAGGACCCACCGGG + Exonic
1006669409 6:35720345-35720367 CTGTCCCTGCAGCCCACACCAGG + Exonic
1006746626 6:36347265-36347287 CAGGTCCTGAAGCCCCCACCTGG + Intergenic
1007594574 6:43043590-43043612 CTGGTCCAGCAGCCAACCCAGGG + Exonic
1012054404 6:94387182-94387204 CCAGTCCTGCAGCCCACTACTGG + Intergenic
1016614346 6:146029065-146029087 CTGTTCCTGCAGCCGATATCAGG + Intronic
1018214544 6:161514343-161514365 CCTGTCCTGCAGCTCAGACCCGG - Intronic
1018632526 6:165833556-165833578 CTGCTCCTCCAGCCCTCAGCTGG - Intronic
1019139187 6:169932850-169932872 CTGGTCCTGCTGCACACGGCTGG + Intergenic
1019779172 7:2929642-2929664 CTGGGGCTGCAGCCCAGAGCAGG + Intronic
1020016563 7:4835058-4835080 CTGGTCCTGGAGCCCATCCCCGG - Exonic
1021104046 7:16616719-16616741 CTGGTCCCCCAGCCCTCATCAGG - Intronic
1022704125 7:32787264-32787286 CTGGGCCTGCCCCCCACTCCTGG + Intergenic
1022908306 7:34877006-34877028 CTGGGCCTGCCCCCCACTCCTGG + Intronic
1023878470 7:44305698-44305720 TTGGTCCTGCTGCCAACTCCCGG - Intronic
1024639535 7:51317525-51317547 CAGGTCCTGCCGGCCACGCCGGG + Intergenic
1026494669 7:70892146-70892168 CTGATCTTGTAGCCCCCACCTGG + Intergenic
1029596173 7:101538645-101538667 CCCGTTCTGCAGCCCACAGCAGG + Intronic
1029609428 7:101618818-101618840 GCAGCCCTGCAGCCCACACCAGG + Intronic
1029664091 7:101983327-101983349 CTGGGGCTGGAGACCACACCTGG - Intronic
1030686252 7:112490057-112490079 CTGGTCAGGCAACCCACCCCTGG + Exonic
1032057255 7:128693637-128693659 CTGGGCCTGGTGCCCACACATGG + Intergenic
1034945685 7:155260317-155260339 CTGGGCCTGCACCCCTGACCCGG + Intergenic
1035426982 7:158784518-158784540 CTGGTTCTGCAGTCCACATGTGG - Intronic
1035447070 7:158950372-158950394 CTGGTCCTGGTGCTCACACCTGG - Intronic
1036183012 8:6601068-6601090 GTGGCCCTGCAGCCAGCACCTGG + Intronic
1037889961 8:22618832-22618854 CTGGACCTGCTGCCCCCTCCTGG + Exonic
1039586646 8:38712681-38712703 CCGGTGCTGCAGCCCACACCTGG - Intergenic
1040106192 8:43543563-43543585 CCGGTCCTGCAGCCCACAGATGG - Intergenic
1041201624 8:55455205-55455227 CTGGCCCTGGACCGCACACCCGG + Intronic
1043982653 8:86659061-86659083 CTGCTCCTGGAGCCCCCAGCAGG - Intronic
1044008697 8:86966122-86966144 CTGGTCCTGCAGACCAGAGTGGG - Intronic
1047429278 8:124776530-124776552 CTGGTCCTGCAGCTTTCACTCGG + Intergenic
1048367850 8:133753996-133754018 CCAGTCCTCCAGCCCACACATGG - Intergenic
1048858356 8:138703318-138703340 CTGGTCCTGCAGGCCCTCCCGGG - Exonic
1049302182 8:141877368-141877390 CTGGTGCTGCAACCCACGCTTGG + Intergenic
1049665296 8:143840319-143840341 CAGGGCCTGCAGCCCACGCTTGG - Intronic
1049693923 8:143974550-143974572 CTGGCCTTGCAGCCCTCTCCTGG + Intronic
1051033856 9:12718786-12718808 CTGGTCCTGCACCCCAGACGCGG - Intergenic
1051963189 9:22793338-22793360 CTGGATCTGCAGCCCACAGTAGG - Intergenic
1054458756 9:65450611-65450633 CAGTCCCTGCAGCCCATACCTGG + Intergenic
1055591280 9:77817133-77817155 CTGTTCCTGAATCCCACGCCAGG + Intronic
1056311649 9:85347236-85347258 GTGGTCCTGCTGCACTCACCTGG + Intergenic
1056691287 9:88810780-88810802 CTGGGTCTGCTGCCCACCCCTGG - Intergenic
1056713585 9:89010602-89010624 CTGGTCCTGCAGAGTGCACCTGG - Intergenic
1056930747 9:90874622-90874644 CTGGGGCTGGACCCCACACCAGG - Intronic
1060551025 9:124485494-124485516 CAGGTCCTGCCGTCCACCCCCGG - Intronic
1061382723 9:130268143-130268165 CGTGTCCTGAAGCCCAGACCAGG + Intergenic
1061572898 9:131488611-131488633 CTGCTCCTGCAGCCCCCAGACGG + Intronic
1061702576 9:132427248-132427270 CTGTTCCTGCAGCCCATTCACGG + Intronic
1061840481 9:133356250-133356272 CCCGGCCTGCAGCCCTCACCTGG + Exonic
1061991054 9:134159002-134159024 CTGGCCCTGCAGCCCTCATAGGG - Exonic
1062094127 9:134694355-134694377 CTGGTCCTGTATCCCCCACTGGG + Intronic
1062243711 9:135552789-135552811 CTGGTCCTTCAGGCCTCACAGGG + Intergenic
1062318606 9:135979792-135979814 CTGGGTCTGCAGACCACCCCAGG + Intergenic
1062427634 9:136513208-136513230 CTGGGCCTGCTCCCCACCCCAGG + Intronic
1062696128 9:137877419-137877441 CTGGGGCTGCAGCCCAGAGCTGG - Intergenic
1186198520 X:7133121-7133143 CTTTTCCTGCATTCCACACCAGG - Intronic
1188116621 X:26251949-26251971 CTGGGACTACAGGCCACACCTGG + Intergenic
1188957814 X:36454378-36454400 CTCTTCCTGCAACCCACATCAGG + Intergenic
1191135439 X:57058955-57058977 CTGGTGTTGCAGCCGACACTGGG + Intergenic
1193600597 X:83504976-83504998 CTGATCTTGAAGCCCAAACCCGG - Intergenic
1195656650 X:107337645-107337667 CTGTTCCTTCAGCTCCCACCAGG - Intergenic
1199996709 X:153030621-153030643 CTGGTCCCTCATCCCACATCAGG + Intergenic
1200080784 X:153575408-153575430 CTGTGGCTGCACCCCACACCAGG - Intronic
1200139640 X:153893067-153893089 CTGGACCAGGAGCCCGCACCTGG - Intronic
1200217696 X:154375207-154375229 CTGTTTCTGCTGCCCACCCCAGG - Intergenic