ID: 901687286

View in Genome Browser
Species Human (GRCh38)
Location 1:10949899-10949921
Sequence CCTTTTCCACAGGTGGGGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 234}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901687274_901687286 10 Left 901687274 1:10949866-10949888 CCCAACACCCTGCTGAAGGGACC 0: 1
1: 0
2: 0
3: 12
4: 148
Right 901687286 1:10949899-10949921 CCTTTTCCACAGGTGGGGAACGG 0: 1
1: 0
2: 2
3: 34
4: 234
901687275_901687286 9 Left 901687275 1:10949867-10949889 CCAACACCCTGCTGAAGGGACCA 0: 1
1: 0
2: 2
3: 44
4: 1581
Right 901687286 1:10949899-10949921 CCTTTTCCACAGGTGGGGAACGG 0: 1
1: 0
2: 2
3: 34
4: 234
901687276_901687286 3 Left 901687276 1:10949873-10949895 CCCTGCTGAAGGGACCATGAGTG 0: 1
1: 0
2: 1
3: 14
4: 148
Right 901687286 1:10949899-10949921 CCTTTTCCACAGGTGGGGAACGG 0: 1
1: 0
2: 2
3: 34
4: 234
901687277_901687286 2 Left 901687277 1:10949874-10949896 CCTGCTGAAGGGACCATGAGTGA 0: 1
1: 0
2: 1
3: 11
4: 121
Right 901687286 1:10949899-10949921 CCTTTTCCACAGGTGGGGAACGG 0: 1
1: 0
2: 2
3: 34
4: 234
901687270_901687286 29 Left 901687270 1:10949847-10949869 CCTAAGGAAGCAAAATCCTCCCA 0: 1
1: 0
2: 0
3: 30
4: 299
Right 901687286 1:10949899-10949921 CCTTTTCCACAGGTGGGGAACGG 0: 1
1: 0
2: 2
3: 34
4: 234
901687272_901687286 13 Left 901687272 1:10949863-10949885 CCTCCCAACACCCTGCTGAAGGG 0: 1
1: 0
2: 3
3: 34
4: 305
Right 901687286 1:10949899-10949921 CCTTTTCCACAGGTGGGGAACGG 0: 1
1: 0
2: 2
3: 34
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901687286 Original CRISPR CCTTTTCCACAGGTGGGGAA CGG Intronic
900242806 1:1624979-1625001 CTCTTTCCCCAGGAGGGGAAGGG + Exonic
900765776 1:4504287-4504309 CCTTTTCCATGGGTGAGGAAGGG - Intergenic
901204923 1:7489150-7489172 CCTTTGCCACAGGTGGGCCCTGG + Intronic
901210717 1:7524546-7524568 GCTCTTCCACAGATGAGGAATGG - Intronic
901221752 1:7587316-7587338 CCCTTTCCAGAAGTGGGGAAAGG - Intronic
901323356 1:8352325-8352347 CTGTTACCCCAGGTGGGGAAGGG - Intergenic
901662416 1:10806822-10806844 CCTTTTCCACTGGCCAGGAAGGG + Intergenic
901687286 1:10949899-10949921 CCTTTTCCACAGGTGGGGAACGG + Intronic
901756747 1:11446028-11446050 CCTTTTGCACAGGTGGGCACAGG + Intergenic
902310462 1:15577991-15578013 CCTATTTTACAGGTGAGGAAGGG + Intronic
905534612 1:38710844-38710866 CCTCTTCCCCAGTTGGGGGAGGG - Intergenic
911182977 1:94877300-94877322 CCTTTTCCCCTGGTAGGTAAGGG + Intronic
912333392 1:108840715-108840737 CTTTTTCAACCAGTGGGGAAAGG + Intronic
912932844 1:113980191-113980213 CCTTTTCTGCAGGAGTGGAAGGG + Intronic
914515751 1:148372699-148372721 CCATCTTCACAGATGGGGAAGGG - Intergenic
915205799 1:154269605-154269627 TGTTTTCCACAGCTGGGGAAGGG - Intronic
919506931 1:198410610-198410632 GCTTCTCAACAGCTGGGGAAGGG + Intergenic
920843741 1:209576471-209576493 TCCTTTCCACAAGTGGGGAAGGG + Intergenic
1063580522 10:7302117-7302139 CATTTTCCGCAAGTGGAGAAAGG - Intronic
1063881333 10:10535782-10535804 CCTTATCCACAGGAGCAGAATGG + Intergenic
1064744021 10:18461547-18461569 ATTTTTCCACAGGTGGGGAGGGG + Intronic
1067157347 10:43793145-43793167 CCTTTTGCAAAGGAGAGGAAAGG - Intergenic
1067931616 10:50567796-50567818 CTTTTTCCACAGGGGGAAAAGGG + Intronic
1069539012 10:69279263-69279285 CCTCTTCCTCATGTGGTGAAGGG + Intronic
1070718702 10:78741402-78741424 TCTTTTCCTGTGGTGGGGAAGGG - Intergenic
1071323992 10:84493718-84493740 ACTTTTCCACAGATGGGGAGAGG + Intronic
1071752950 10:88502282-88502304 CCTTTAGCAGAGGTGGGGTAGGG + Intronic
1072056050 10:91756957-91756979 ATTTTTCCACAGATGGGGATGGG + Intergenic
1072494127 10:95937716-95937738 CATTTTCCATAGGGGAGGAAGGG + Intronic
1075848222 10:125564453-125564475 ACTTTTCCACAGGCTGGGGAGGG + Intergenic
1076171704 10:128325354-128325376 CTTTTTCTACAGGAGCGGAAAGG - Intergenic
1076194244 10:128504155-128504177 CCTTGTCCTCAGGTTGGGAGTGG + Intergenic
1076807434 10:132866103-132866125 CAGCATCCACAGGTGGGGAAAGG + Exonic
1079296541 11:19240480-19240502 CCTTTTCTACAGATGGGAGAGGG - Intronic
1080569870 11:33546052-33546074 GCTTTGCTACAGCTGGGGAATGG - Intronic
1080653323 11:34239813-34239835 CCTTGTCAAGAGGTGGGGGAGGG - Intronic
1081610486 11:44559900-44559922 CCATTTCCACATCTTGGGAATGG + Intergenic
1082841384 11:57692950-57692972 CTTTTTCCACAGATGGGGGCTGG + Intronic
1082986589 11:59174592-59174614 CCCTTTCCAAATGTGGGAAAGGG - Intronic
1083228540 11:61300262-61300284 GCTCTCCCACAGGTGGGGAAGGG + Intronic
1086058359 11:82674867-82674889 CCTTTTTCATATTTGGGGAATGG - Intergenic
1086538494 11:87879354-87879376 ACTTTTCAACATGTGGGGCATGG + Intergenic
1086840020 11:91673453-91673475 CCTTTTCTACAGGTATAGAAAGG - Intergenic
1088641598 11:111878545-111878567 ATTTTTCCAAAGGTGAGGAAAGG - Exonic
1089730479 11:120515938-120515960 CCTTTTCCACAGATGAGGAAGGG + Intronic
1089768620 11:120786450-120786472 CCTTTTCCACTGGACAGGAAAGG - Intronic
1090626546 11:128613691-128613713 TCTTTTCTACAGGAAGGGAAGGG - Intergenic
1091874650 12:3924016-3924038 CCTTTTCAATAGATGGAGAAGGG + Intergenic
1093158352 12:15715210-15715232 CCTTGTCCCCAGTTGGAGAAAGG - Intronic
1093411897 12:18877602-18877624 ATTTTTCCACAGATGGGGTAAGG + Intergenic
1093982541 12:25490537-25490559 CATTTTACAGAGGTGCGGAAGGG + Intronic
1094164973 12:27434723-27434745 CTATTTCCATAGCTGGGGAATGG - Intergenic
1096561279 12:52437703-52437725 CCTCTTCCACAGATGAGGAGTGG + Intergenic
1097272970 12:57789946-57789968 CCCATTCCACAGTTGGGGAAAGG - Intronic
1097687002 12:62700416-62700438 GCTTTGCCACAGGTGGAGACAGG - Intronic
1100993684 12:100279149-100279171 GTTTTTCCACAGATGGGGGATGG + Intronic
1102560261 12:113756981-113757003 CCTCTTCCCCAGGTCGGGCAGGG + Intergenic
1102638117 12:114342348-114342370 CCCTTTTCAGAGGTGGGGAAGGG - Intergenic
1102837528 12:116079392-116079414 CCTTTTGCAGAGATGGGGGAGGG + Intronic
1104100919 12:125608796-125608818 CCTTTTCAACAAGTGGTGATGGG - Intronic
1104515643 12:129423554-129423576 TGTCTTCCACAGGAGGGGAAGGG + Intronic
1106951860 13:34893264-34893286 CCTTCTCGGAAGGTGGGGAAGGG - Intergenic
1109274695 13:60290665-60290687 GCTCTTCCTCAGGTGGAGAAGGG + Intergenic
1110334234 13:74308151-74308173 CCATTTTCACAGGTGTGGATGGG + Intergenic
1111849769 13:93557966-93557988 CATTCTCCATAGTTGGGGAAGGG + Intronic
1112943529 13:104895706-104895728 CCCTTTCCACAGCTGGGATAAGG - Intergenic
1117477772 14:56114739-56114761 CATATTCCATAGGAGGGGAATGG + Intergenic
1118742517 14:68750145-68750167 CCTTATCCAGTGGTGGGGAGCGG - Intergenic
1119157704 14:72426733-72426755 CCTTTTCCACATGGGTGGCATGG + Intronic
1119169313 14:72521769-72521791 CCTGTTCTACAGATGAGGAAAGG - Intronic
1119400338 14:74358464-74358486 CCTTTGCCCAAGGTGGGGACCGG - Exonic
1120024906 14:79571830-79571852 CATTTTCCACATGTCGGGTAAGG - Intronic
1120454012 14:84708452-84708474 GATTTCCCACATGTGGGGAAGGG - Intergenic
1121177076 14:91898612-91898634 ACTTTTCCACTGATGCGGAAAGG - Intronic
1121266127 14:92603777-92603799 CCTTTTCCTCAGGCAGGAAAGGG + Intronic
1121792013 14:96705687-96705709 CCTTTTCCCCAGGGGAGGAAAGG - Intergenic
1122071056 14:99205581-99205603 CCTTTTCCAGAGGAGGAAAAAGG + Intronic
1122239828 14:100355647-100355669 CCTTTTCCAGAGGTCTGGATAGG + Intronic
1124089486 15:26584804-26584826 CCTTTGACAGTGGTGGGGAAAGG - Intronic
1124574109 15:30892648-30892670 ATTTTTCCACAGATGGGGTAAGG - Intergenic
1125499715 15:40232028-40232050 GTTTTTCCACAGATGGGGGATGG + Intergenic
1125744258 15:41988067-41988089 GTTTTTCCACAGGTGGACAAGGG - Exonic
1126150800 15:45522458-45522480 CGTTTTCCACAGGATGGGGAGGG - Exonic
1127288187 15:57548631-57548653 TCTTTTACACAGGTTGGGTAGGG + Exonic
1128185986 15:65643843-65643865 CCTTTTCCACTGGAGAGGGAAGG + Intronic
1128271558 15:66314767-66314789 CCTTTTTAAAAGGTGGTGAAGGG + Intronic
1129859700 15:78851070-78851092 CCCCTTCCAGAGCTGGGGAATGG + Intronic
1131510824 15:93048684-93048706 CCGTTTCCATAGGTCAGGAATGG - Intronic
1132898161 16:2238581-2238603 CCCGTCCCACAGATGGGGAACGG - Exonic
1134320623 16:13159345-13159367 CCTCTTCCACAGCTAGGAAAAGG - Intronic
1134876559 16:17705024-17705046 CCTTTTCCAGAGTTGGGAATTGG - Intergenic
1135167802 16:20156177-20156199 CCTTCTACTCAGGTGGGGAAGGG + Intergenic
1137538333 16:49344338-49344360 CCGTCTCCTCAGGTGGGGATGGG + Intergenic
1137674393 16:50297103-50297125 CCTATTGCACAGATGGGGAAAGG + Intronic
1139710326 16:68771003-68771025 CCTCCTCCACTGGCGGGGAAAGG - Intronic
1140802146 16:78498392-78498414 CCTTGCCCCTAGGTGGGGAAGGG - Intronic
1141371007 16:83486394-83486416 GCTATTGCCCAGGTGGGGAAGGG + Intronic
1143119346 17:4597378-4597400 CTTCTTCCCCAGGTGGGGCATGG + Intronic
1143472572 17:7185206-7185228 CCTTCTCCATAGCAGGGGAAGGG - Intergenic
1145055537 17:19701480-19701502 TTTTTTCCCCAGGTAGGGAAAGG + Intronic
1146684936 17:34835248-34835270 CCTTTGGCACAGGTGGGCAGGGG - Intergenic
1146839621 17:36141558-36141580 CCTTTTGCACAGGTGTTGATGGG - Intergenic
1146935559 17:36810677-36810699 CTTTTTCCCCAGGTGGGAAGTGG + Intergenic
1148565439 17:48630101-48630123 CCTTTTCCATAGGTGTGTGATGG - Intronic
1149147416 17:53512747-53512769 CCGTTTTCACAGTTTGGGAAGGG + Intergenic
1150273375 17:63880995-63881017 CCTTCTCCCCAGGTGGGGATGGG - Intronic
1150278977 17:63917983-63918005 CCTTCTCCCCAGGCGGGGATGGG - Intronic
1150853179 17:68725255-68725277 CCCTTTGCACTGGTGGAGAATGG + Intergenic
1151169991 17:72237766-72237788 CCTGTTCCACAGGAAGGAAATGG - Intergenic
1151543507 17:74777312-74777334 CCATTTCCAAAAGTGAGGAAGGG - Exonic
1151958962 17:77394984-77395006 GTTTTTCCAGAGGTGGGGATGGG + Intronic
1157552913 18:48593847-48593869 CCTTTGCCTCAGGTGGGGTTAGG + Intronic
1159036909 18:63286286-63286308 CCTTTTACACAGTTGGGGGCAGG + Intronic
1160979797 19:1811733-1811755 CCTTTTCCTCATGCGGTGAATGG - Exonic
1165035763 19:33032403-33032425 CCTTCTCCAGAGGTGGTGTAGGG + Intronic
1167497278 19:49827063-49827085 CCTCTCCCACAGGCGGGGATGGG - Intronic
925095266 2:1193355-1193377 CCTTTTCATCAGGTGGTGAGCGG - Intronic
925863670 2:8204048-8204070 CCTGTTCTACAGCTGAGGAAGGG - Intergenic
926161705 2:10494426-10494448 CCTTTTCCAGACGTGGGCCATGG + Intergenic
926356359 2:12044262-12044284 CCTATTCCAGAGATGGGAAAAGG + Intergenic
930609604 2:53526908-53526930 CCTCTACCAGAGCTGGGGAAGGG - Intergenic
931425182 2:62164394-62164416 ATTTTGCCACAGGTGGGCAAGGG + Intergenic
933056998 2:77683133-77683155 ATTTTTCCACAGATGGGGCACGG + Intergenic
933733373 2:85475490-85475512 CGTTGTCAACAGATGGGGAAGGG + Intergenic
933832629 2:86223167-86223189 CGTCTTCCACAGCAGGGGAATGG + Intronic
933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG + Intergenic
933978689 2:87532812-87532834 CCTTTTCTACAGGGGCTGAATGG - Intergenic
935083224 2:99819868-99819890 CCTCTTCCCCAGGAGGGGGAAGG - Intronic
935360853 2:102245325-102245347 CCTCTTCCTCAGGTGGGGGCTGG - Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936315143 2:111417983-111418005 CCTTTTCTACAGGGGCTGAATGG + Intergenic
936815632 2:116456939-116456961 CCTTGGCCACAGCTGGGGAAGGG - Intergenic
938880487 2:135581339-135581361 AATGTTCCACAGGTGGGAAATGG - Intronic
939704430 2:145434852-145434874 CCTTTGCCAAAGGTAGGCAATGG + Intergenic
943272360 2:185822964-185822986 CCTTTTCCACAAGTGGTGATGGG + Intronic
944113419 2:196160334-196160356 CCTTTGCCTCAGTTGGGGGAGGG + Intronic
944293111 2:198030430-198030452 GTTTTTCCACAGTTGGGGAAAGG + Intronic
946025969 2:216671892-216671914 GCTTTCCAACAGATGGGGAAGGG + Intergenic
946387746 2:219395428-219395450 CTTGTTCCACAGGATGGGAAGGG + Intronic
947000875 2:225454776-225454798 CTTTTTCCACAGATGGGGAGGGG - Intronic
948627834 2:239279996-239280018 CCTCTTCCGCAGGAGTGGAAGGG - Intronic
948888103 2:240893829-240893851 CCTGTCTCACAGGTGGGGACAGG + Intronic
1172177944 20:32983999-32984021 GCCTTTCCAAAGGTGGGGAGTGG + Intronic
1172799518 20:37566208-37566230 CCTTTTTCCAAGGTGGGGACAGG + Intergenic
1173065192 20:39703926-39703948 CCTTTGCCAAGAGTGGGGAAGGG + Intergenic
1174280519 20:49435643-49435665 TCTTTTTTACAGGTGAGGAAAGG - Intronic
1174545166 20:51319661-51319683 CCCTGACCACAGGAGGGGAAGGG - Intergenic
1175317900 20:58064549-58064571 CTTGTTCCACAGTTGGGGATCGG + Intergenic
1175685867 20:61028523-61028545 CAGTTTCAACAAGTGGGGAAAGG + Intergenic
1178421266 21:32445315-32445337 GCTTATCCACAGATGTGGAATGG - Intronic
1178920897 21:36737484-36737506 CCTGGTCCATAGGTGGAGAAGGG + Intronic
1179156225 21:38853442-38853464 ACTTGCCCACAGGTGGGGATGGG - Intergenic
1183324401 22:37183632-37183654 TGTTTTCCACAGGGGGGGAAGGG + Intronic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1183941982 22:41301246-41301268 CTTTTGACACAGATGGGGAAGGG + Intergenic
1185345682 22:50309557-50309579 TCTTCTGCACAGGTGGGGACAGG + Exonic
950554650 3:13688101-13688123 CCTATTCCACAGATGAAGAAGGG + Intergenic
950581672 3:13866352-13866374 CCATTCCCACAGGTGGCGAGAGG - Intronic
951753276 3:26060765-26060787 CCTTTTCCATCTGTGGGAAAGGG + Intergenic
952459005 3:33504656-33504678 ATTTTTCCACGGATGGGGAAGGG + Intronic
953426858 3:42802699-42802721 CTTATTTTACAGGTGGGGAAAGG + Intronic
953565693 3:44029938-44029960 CCTTTTCCATAGGAAGGGACTGG - Intergenic
953573482 3:44093013-44093035 CCTTCTACACAGCTGGGGAAGGG + Intergenic
953666418 3:44929262-44929284 CCATTTCCACACCTGGGGATGGG - Intronic
954992104 3:54850296-54850318 CCTGTTCTCAAGGTGGGGAATGG + Intronic
955913033 3:63877922-63877944 CTTTTTCCACAGGAGAGGACTGG - Intronic
956100715 3:65765267-65765289 CCTTTACCAAAGGAGGGGAAAGG + Intronic
956895743 3:73658073-73658095 AATTTTCCAGAGGTGAGGAATGG - Intergenic
957913621 3:86656416-86656438 CATTTTCCTCAGTTGGGAAATGG - Intergenic
958822844 3:98995577-98995599 GTTTTTCCACAGGAGGGGAAGGG + Intergenic
958878074 3:99638300-99638322 TCTTGACCACAGATGGGGAAAGG - Intergenic
960302832 3:116024833-116024855 CATTTCCCACATGTGGGCAAAGG + Intronic
963699167 3:148602182-148602204 CTTTTTCTACTGCTGGGGAAAGG - Intergenic
964541119 3:157781180-157781202 CCATTTTCTCAGGTGTGGAATGG - Intergenic
967949866 3:194832450-194832472 CCTCTGCCACAGATGAGGAAAGG + Intergenic
969050844 4:4371816-4371838 CCTTTTCCACAGGAGAACAATGG + Intronic
969642577 4:8407868-8407890 CCGTGTCCCCTGGTGGGGAAGGG - Intronic
973530600 4:51833714-51833736 CCCCTTTCACAGGTGAGGAAAGG - Intergenic
975622359 4:76307321-76307343 CCCTTTCCAAAGGCCGGGAAGGG - Intronic
975647084 4:76555821-76555843 CTTTTCCCAGAGGTGGGGTAGGG - Intronic
977058527 4:92225172-92225194 CCTATTCAACAGCTGGGGATAGG - Intergenic
977235181 4:94499948-94499970 ATTTTTCCACAGGTGGGTCAGGG - Intronic
978275978 4:106950445-106950467 CCTTTTCCACAGGTGCAGTAGGG - Intronic
978674025 4:111288066-111288088 CTTTTACCATAGCTGGGGAATGG - Intergenic
978841224 4:113215285-113215307 CCTTCTTTACAGATGGGGAATGG - Intronic
979298282 4:119057215-119057237 ACTTTTGCAAAGGTGGGGACAGG + Intronic
980017140 4:127662706-127662728 CATTTTCCACAGGTATGGAAAGG - Intronic
985824242 5:2180957-2180979 CCCTTTCTACAGTTGGGGACCGG + Intergenic
987035250 5:14012807-14012829 GTTTTTCCACAGGTGGGGCAGGG + Intergenic
987073317 5:14358167-14358189 CCACGTCCACAGCTGGGGAAGGG - Exonic
987297896 5:16570155-16570177 GCTTCTCCACAGGTAGGAAATGG + Intronic
987907921 5:24103099-24103121 CATTTTCCACTGTTGGAGAATGG - Intronic
989472487 5:41836558-41836580 CTTTTTCCACAGATGGGGGTTGG + Intronic
991066235 5:62427759-62427781 ATTTTTCCACAGATGGGGCAGGG - Intronic
991558545 5:67923681-67923703 CCTTTTCCAGAGGCAGAGAAAGG - Intergenic
992175875 5:74148302-74148324 CATGTTCCAAAGTTGGGGAAGGG + Intergenic
994689396 5:102998529-102998551 CATATTCCACAGGTCGGGATGGG + Intronic
995123253 5:108557467-108557489 CCCTTGCCACAGATGGGAAAGGG - Intergenic
998240787 5:140442405-140442427 ATTTTTCCACACGTGGGGGAGGG + Intronic
998921810 5:147077366-147077388 AGTTTTCCTCAGGTGTGGAATGG - Intronic
999119583 5:149198761-149198783 CCTCATCCACAGGTGGGACAGGG + Intronic
999517814 5:152318563-152318585 CCTTTACCACAGGAGAGGACAGG + Intergenic
999671740 5:153964592-153964614 CCTCATCCACAGCTGGGCAAGGG + Intergenic
999776742 5:154817991-154818013 ACTTTTCCACAGGGGGGTGAAGG + Intergenic
1000191391 5:158914386-158914408 CATTTTTCACTGGAGGGGAAAGG + Intronic
1000822569 5:166002634-166002656 CATTTTCCACAGCTGGCTAAGGG + Intergenic
1001081507 5:168671121-168671143 CCTATTTCTCAGGTGGGGTAGGG + Intronic
1001471962 5:172020817-172020839 CCTTGGCCACAGCTGGAGAAAGG + Intergenic
1001823319 5:174726208-174726230 CCTTTCCTACAGGTAGGGGATGG - Intronic
1003034475 6:2631240-2631262 CCATTTCCGCAGGTGGAAAATGG + Intronic
1003424987 6:5993025-5993047 CCTCCTGCACTGGTGGGGAAGGG - Intergenic
1004701869 6:18087158-18087180 CCACTCCCACAGGTGGGAAAAGG + Intergenic
1005013231 6:21355636-21355658 CATATTCCACAGGATGGGAAAGG + Intergenic
1005998415 6:30946568-30946590 ACTGTTTTACAGGTGGGGAAAGG - Intronic
1006113280 6:31761658-31761680 CATTTCCCAGAGGTGGGGATTGG + Intronic
1006117529 6:31783085-31783107 ACTTTGGCACAGGTGGGCAAGGG - Exonic
1008059814 6:46985215-46985237 ACTTCTCCACAGGTGGGAGAAGG - Intergenic
1008646948 6:53524203-53524225 CCCATTTCACAGGTGGGCAAAGG + Intronic
1009674393 6:66797980-66798002 TCTTTTCCACAGGAAAGGAAGGG + Intergenic
1010877149 6:81120763-81120785 ACTTTTCCACAGATGGGGTGTGG - Intergenic
1012175670 6:96079162-96079184 ACATTTTCAAAGGTGGGGAAGGG + Intronic
1015787118 6:136929679-136929701 CCCTTTCCCCAGGTGGGATAAGG + Intergenic
1016457710 6:144248338-144248360 CCTCTGCCACAGGTGGGGTGGGG - Intergenic
1017522086 6:155211365-155211387 CCTTTACCTAAGGTGGGGAAAGG + Intronic
1018969678 6:168517734-168517756 CCTTTTCCTCAGCTGGGGCTGGG + Intronic
1019830081 7:3319262-3319284 CCTTTTCCACAGGAGAGGGATGG + Intronic
1021709049 7:23396943-23396965 CCATTTTCACAGATGGGAAAGGG + Intronic
1023153065 7:37220805-37220827 CTTCTTTCACAGATGGGGAAAGG + Intronic
1024854981 7:53768391-53768413 ATTTTTCTACATGTGGGGAATGG + Intergenic
1026223354 7:68419371-68419393 TCTTGTCAAGAGGTGGGGAAGGG - Intergenic
1029111560 7:98215234-98215256 GCTTCTCCACTGGTGGGGATGGG - Exonic
1031018777 7:116604206-116604228 ACTTCTCCACCTGTGGGGAAGGG + Intergenic
1032752693 7:134857494-134857516 ACTTTTCCTCAGGTAGGGAATGG - Intronic
1032896030 7:136251742-136251764 CCCTTTTCTCAGGTGGGGAATGG + Intergenic
1033036481 7:137880273-137880295 CCTTCTGCACAGGAGGGGCATGG + Exonic
1033371806 7:140715626-140715648 TCTTTTCCACATGTGGGCCATGG + Intronic
1033886997 7:145961275-145961297 CCTTGTCCACAGGTGAGGGAGGG + Intergenic
1034953301 7:155316112-155316134 CCGTTGCCACAGATGGGGAGAGG + Intergenic
1035272492 7:157728607-157728629 GCTTTTGAAGAGGTGGGGAAAGG + Intronic
1036578596 8:10052378-10052400 TTTTTTCCACAGATGGGGAAGGG - Intergenic
1036805584 8:11830409-11830431 GCTATTCCACAGGTAGGGAAGGG + Exonic
1037472672 8:19225755-19225777 CATTTTCCTGAGATGGGGAAAGG - Intergenic
1039547197 8:38418793-38418815 CCATTTCCTCCCGTGGGGAAGGG + Intronic
1041281569 8:56215427-56215449 ATTTTTCCACGGATGGGGAAGGG + Intronic
1041313339 8:56538220-56538242 CCATGTCCCCAGGTGGGCAAGGG - Intergenic
1044064953 8:87687945-87687967 CCTTTTCCACAGATGGGGGTTGG + Intergenic
1045939774 8:107726313-107726335 CCTTTATCAGAGGTGGGGAGGGG + Intergenic
1046921881 8:119739346-119739368 CCTTTTCCTGAGGTAAGGAAGGG - Intronic
1047559921 8:125975791-125975813 CTTTCTCCACAGATGGGGATGGG + Intergenic
1048014530 8:130485636-130485658 CCTCCTCCACAGGTGGGATATGG - Intergenic
1050524147 9:6530838-6530860 ACTCTTACACATGTGGGGAAGGG - Intergenic
1050627951 9:7525980-7526002 CCATTTCTCCTGGTGGGGAATGG + Intergenic
1051372803 9:16372672-16372694 CCTTTTCCTCAGATGGGGAAAGG + Intergenic
1056925244 9:90828854-90828876 CACTTGCCACGGGTGGGGAAGGG - Intronic
1057195535 9:93114100-93114122 CCCATTTCACAGGTGGGCAAAGG - Intergenic
1057497527 9:95572634-95572656 CCATTTCCAAACTTGGGGAAGGG + Intergenic
1059169326 9:112110679-112110701 CCTTGTAGACAGGTGGGGCACGG - Intronic
1061761834 9:132856840-132856862 GCTTTTCCAGGGATGGGGAATGG + Intronic
1061841881 9:133363373-133363395 CCTTTACCAAGGGAGGGGAAGGG + Exonic
1185596761 X:1311835-1311857 CCTTTTCTAGATGTGGGAAATGG - Intergenic
1186572376 X:10728811-10728833 GGTTTTCCACAGGTCTGGAAAGG + Intronic
1186807460 X:13154280-13154302 CCTTTTCCACTGGGAAGGAAGGG - Intergenic
1190951561 X:55150285-55150307 ATTTTTCCACAGATGGGGGAAGG + Intronic
1192496976 X:71622699-71622721 CCTTGACCACAGGTGGGGCCCGG - Intergenic
1196386229 X:115155260-115155282 ATTTTTCTAAAGGTGGGGAAGGG + Intronic
1196479508 X:116130385-116130407 CGGTTTCCAGAGGTTGGGAAGGG - Intergenic
1197779041 X:130141361-130141383 CCTTTTCCACACATGGGTCAGGG - Intronic
1197842875 X:130768679-130768701 CCTGCTCCACAGGCAGGGAAGGG + Intronic
1197852432 X:130877434-130877456 CCTATTCCATATCTGGGGAAAGG - Intronic
1199095600 X:143734988-143735010 CATTTTCATCAGTTGGGGAAAGG + Intergenic
1200152818 X:153959626-153959648 CCATTTCCACAGGTGGGGCCAGG + Intronic