ID: 901689032

View in Genome Browser
Species Human (GRCh38)
Location 1:10960624-10960646
Sequence GCCTCCCGCTCGGGGCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 1, 2: 2, 3: 6, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901689025_901689032 4 Left 901689025 1:10960597-10960619 CCCAGGGCAATGAATAGTTATTG 0: 1
1: 0
2: 1
3: 9
4: 136
Right 901689032 1:10960624-10960646 GCCTCCCGCTCGGGGCCTGTGGG 0: 1
1: 1
2: 2
3: 6
4: 102
901689026_901689032 3 Left 901689026 1:10960598-10960620 CCAGGGCAATGAATAGTTATTGC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 901689032 1:10960624-10960646 GCCTCCCGCTCGGGGCCTGTGGG 0: 1
1: 1
2: 2
3: 6
4: 102
901689020_901689032 21 Left 901689020 1:10960580-10960602 CCCCTGGGCACACTTAACCCAGG 0: 1
1: 0
2: 0
3: 15
4: 115
Right 901689032 1:10960624-10960646 GCCTCCCGCTCGGGGCCTGTGGG 0: 1
1: 1
2: 2
3: 6
4: 102
901689024_901689032 19 Left 901689024 1:10960582-10960604 CCTGGGCACACTTAACCCAGGGC 0: 1
1: 0
2: 0
3: 19
4: 138
Right 901689032 1:10960624-10960646 GCCTCCCGCTCGGGGCCTGTGGG 0: 1
1: 1
2: 2
3: 6
4: 102
901689022_901689032 20 Left 901689022 1:10960581-10960603 CCCTGGGCACACTTAACCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 110
Right 901689032 1:10960624-10960646 GCCTCCCGCTCGGGGCCTGTGGG 0: 1
1: 1
2: 2
3: 6
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901689032 Original CRISPR GCCTCCCGCTCGGGGCCTGT GGG Intronic
901689032 1:10960624-10960646 GCCTCCCGCTCGGGGCCTGTGGG + Intronic
903291782 1:22318649-22318671 GCCTCCCTCTCGGGCTTTGTGGG + Intergenic
906117618 1:43366815-43366837 CCCTCCCCCTCAGGGCCTGAAGG + Intronic
907298451 1:53470371-53470393 GCCTCCCACTAGGAGCATGTGGG + Intergenic
907457491 1:54584896-54584918 GGCCCCTGCTCTGGGCCTGTGGG - Intronic
915914381 1:159932222-159932244 GCCTCCCTCTCTGGGGCTCTGGG - Intronic
921075301 1:211695811-211695833 GCCTCCTCTTCGGGGCCTCTGGG - Intergenic
924052774 1:240093581-240093603 GCCTCCCACCCGGGGCGTGCGGG - Exonic
1067328472 10:45292369-45292391 GCCTCCCTTCTGGGGCCTGTAGG - Intergenic
1072633729 10:97164350-97164372 GGCTCCCGCTGGAGGCCTGGGGG + Intronic
1076240415 10:128900830-128900852 GCCTCCTGGTTGGGGCCTGAAGG + Intergenic
1077059273 11:610601-610623 GCCTGCCGCTAGTGGGCTGTGGG + Exonic
1077367912 11:2168603-2168625 GCCCCCAGCTCGCGGCCTCTGGG + Exonic
1079078246 11:17396761-17396783 GTCTCCTGCCCTGGGCCTGTGGG - Intronic
1083809612 11:65096305-65096327 GCCTCCCCCTCGGGCCCTTCTGG - Exonic
1084385616 11:68841439-68841461 GCCTCCGGCCCGGGGCCAGCGGG - Intronic
1084860371 11:72014132-72014154 GCCTCCAGCTTGGGGCCTGTTGG + Exonic
1091330549 11:134728216-134728238 GACTCCCGCCCTGGGCCTGGTGG + Intergenic
1091387672 12:105103-105125 GCCTGCCCCATGGGGCCTGTGGG - Intronic
1092430785 12:8407115-8407137 GCCTCCCCCTCGGGCCCTTCTGG + Intergenic
1096409054 12:51364355-51364377 GCCTCCTGGTTGGGGCCTGCAGG - Exonic
1096585445 12:52616763-52616785 GCCTTCTGCTCGGGGTCTGGTGG + Intronic
1105443794 13:20435849-20435871 GCCTCCCGCGAGGGCGCTGTCGG - Intronic
1111220994 13:85205341-85205363 GGATCCCGCTCCGGGGCTGTGGG - Intergenic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1118331344 14:64818262-64818284 GCCTCCTGCGAAGGGCCTGTGGG - Intronic
1118776700 14:68978324-68978346 GGCTCCCCCGCGGGCCCTGTGGG - Intronic
1122337627 14:101004395-101004417 GCCTCCATCCTGGGGCCTGTGGG - Intergenic
1127953633 15:63834037-63834059 ACCTCCCGCGCTGGGCCTGTTGG - Intergenic
1128453969 15:67822668-67822690 GGCTCCTGCCCTGGGCCTGTTGG + Intronic
1129250063 15:74303760-74303782 GCTCCCAGCTCGGGGCCTGCAGG - Intronic
1133076167 16:3282912-3282934 GCCTGCTGCGCGGGGCCTGCTGG - Intronic
1133365655 16:5207142-5207164 GCCTCCCCCTCGGGCCCTTCTGG - Intergenic
1139205922 16:65028306-65028328 ACCTCCTGCTTGGGTCCTGTCGG + Intronic
1141267126 16:82507443-82507465 GGCTCCCTCTAGGGGCCTCTGGG + Intergenic
1144702152 17:17346992-17347014 GCTCCCAGCTCGGGGCCTGTGGG + Exonic
1147969658 17:44212573-44212595 GCCTTCCCCTCCTGGCCTGTGGG - Intronic
1148324038 17:46773033-46773055 GCCTCCCTCCCAGGGCCTGCAGG + Intronic
1152123454 17:78432801-78432823 GCCTCCACCTCAGGGCCTGGGGG - Intronic
1152882883 17:82830461-82830483 GCCTCCTCGCCGGGGCCTGTGGG + Exonic
1160962652 19:1730418-1730440 GACTCCCGCTCAGGGGCTCTTGG + Intergenic
1161221745 19:3120982-3121004 GCGTCCCGCTGGGGACCTGGGGG - Exonic
1161267327 19:3370279-3370301 GCCCCCCACCCGGGGCCTGGTGG + Intronic
1161473495 19:4472705-4472727 GCCCCGCCCTCGGGGCCTGGGGG + Intronic
1161577970 19:5065213-5065235 GCCTCAGGCTGGGGCCCTGTGGG + Intronic
1163427100 19:17245754-17245776 GGCTGCCGCTCCGGGCCTGCAGG + Exonic
1165854228 19:38870245-38870267 GTCTCCAGCGCGGGGCCTGCGGG + Exonic
1166269803 19:41707026-41707048 GCCGCCCACTTGAGGCCTGTCGG + Intronic
1166565923 19:43765487-43765509 GCTTCCGGCTGGGGGCCTGAGGG + Intergenic
925928363 2:8685956-8685978 GGCTCTCGCGCGGGGCCTGGTGG + Intergenic
937082588 2:119151083-119151105 GCCTCCCCCTTGGGGCCTTGGGG - Intergenic
944831152 2:203535077-203535099 GCCTCGCCCTCGGGGCCAGGGGG - Intronic
947525069 2:230872692-230872714 GACTGCCGGTCGGTGCCTGTGGG + Intronic
948868783 2:240788035-240788057 GCCCCCCGCTTCGTGCCTGTGGG + Exonic
948933635 2:241149009-241149031 GCCTCCTGCACTGGGCGTGTGGG - Intronic
1171865160 20:30484157-30484179 GCCTCCAGCTCTGGGCCTTTCGG - Intergenic
1171977381 20:31604234-31604256 GCCTCCCGCCCGGGGTCTGCAGG + Intergenic
1175022556 20:55865913-55865935 GCCTGCCTCTGGGGACCTGTAGG + Intergenic
1176090368 20:63315883-63315905 GCCTCCTGCCCGGTGCCTGCTGG + Intronic
1179612177 21:42559490-42559512 GGCTCACGCTCAAGGCCTGTGGG - Intronic
1180086449 21:45509939-45509961 GCCTCCCGCTCAGCGCCCCTCGG + Intronic
1180235846 21:46459005-46459027 GCCTCCCGCTCCTCGCCTGGCGG + Intronic
1182451766 22:30426011-30426033 GACGCCCGCCCGGGGCCTGGAGG + Intronic
1182539695 22:31032142-31032164 GGCTCCCGCTCAAGCCCTGTTGG + Intergenic
1182587138 22:31350607-31350629 GCCTCCTGCTGCTGGCCTGTCGG + Intergenic
1183329376 22:37211329-37211351 GCCCCCAGCGCTGGGCCTGTAGG - Intronic
1183832253 22:40424484-40424506 GCCTGCCTCACGGGGCATGTGGG - Intronic
1184476844 22:44726702-44726724 GCCTCGTGCTGGGGGCCTCTGGG + Intronic
1185320450 22:50198218-50198240 GCCTCCACCTGGGGGCTTGTGGG - Intronic
953223824 3:40998584-40998606 CCCTCCCGCTGGGGCCCTCTGGG - Intergenic
957277542 3:78108805-78108827 GGATCCCGCTCGGGGGCTGCAGG - Intergenic
961279670 3:125756140-125756162 GCCTCCCCCTCGGGCCCTTCTGG - Intergenic
961662543 3:128477362-128477384 GCCTCCTGCTCTGGGGTTGTAGG + Intergenic
961858155 3:129893352-129893374 GCCTCCCGCTCGCGGCCTGTCGG - Intronic
963823509 3:149926073-149926095 GCCTCCCTCTGGAGGCTTGTAGG - Intronic
968818306 4:2832968-2832990 GCCTCCCGCTTCCGTCCTGTAGG + Exonic
968908229 4:3464135-3464157 GCCTGCAGCGCTGGGCCTGTAGG + Intronic
968973917 4:3811287-3811309 GCCTGGCACTCGGCGCCTGTTGG + Intergenic
969609302 4:8218075-8218097 GCCACACGCACGGGGCCTGAAGG + Intronic
969721665 4:8895625-8895647 GCCTCGGGCTCAGGGCCTATGGG + Intergenic
985777071 5:1850200-1850222 CCCTCCTCCTCGGGGCCTTTGGG + Intergenic
985816622 5:2132459-2132481 GCATCGCGCACGAGGCCTGTCGG + Intergenic
985994514 5:3590439-3590461 GCCTCCCGCTTGGGGCCTATCGG - Intergenic
1002520855 5:179792722-179792744 GCCTGAGGCTCGGAGCCTGTTGG - Intronic
1002707198 5:181169979-181170001 GCCTCCTGCTCGGCCCCTGCAGG + Intergenic
1006801810 6:36764673-36764695 GCTTCCCACTCGGGGTCTTTGGG - Intronic
1009523964 6:64719778-64719800 GCCTCCCGTTCTGGGACTATAGG - Intronic
1013587210 6:111590341-111590363 CCCTCCTGCTCTGGCCCTGTTGG - Intronic
1015881917 6:137878740-137878762 GCATGGCGCTCGGGGCCTCTCGG + Exonic
1021758763 7:23882619-23882641 TCCTCCTGCTCTGGGCATGTGGG - Intergenic
1025145289 7:56496278-56496300 GCCTCCAGGTAGGGCCCTGTTGG + Intergenic
1029646026 7:101856580-101856602 GCCTTCCCCTCTGGGCCTGCAGG - Intronic
1033207850 7:139437959-139437981 GGCTCCAGCTAGTGGCCTGTTGG + Intergenic
1036260802 8:7238555-7238577 GCCTCCCCCTCGGGCCCTTCTGG + Intergenic
1036305803 8:7600976-7600998 GCCTCCCCCTCGGGCCCTTCTGG - Intergenic
1036312838 8:7697099-7697121 GCCTCCCCCTCGGGCCCTTCTGG + Intergenic
1036356651 8:8048973-8048995 GCCTCCCCCTCGGGCCCTTCTGG - Intergenic
1036901914 8:12676311-12676333 GCCTCCCACTCGGGCCCTTCTGG + Intergenic
1040110242 8:43564006-43564028 GCCTCTGGCGCAGGGCCTGTTGG + Intergenic
1043121145 8:76326286-76326308 GCCACCCGCTCAGGGTCTCTGGG - Intergenic
1046621280 8:116531462-116531484 GGATCCCGCACGGGGCCTGCAGG - Intergenic
1047403675 8:124567421-124567443 GCCTCCCTCCCAGGGCCTGGGGG + Intronic
1047523925 8:125616383-125616405 GCCTTGAGCTGGGGGCCTGTGGG + Intergenic
1047731883 8:127735268-127735290 GCCTCCCGCACGGGGCCCCACGG + Intergenic
1049529850 8:143148734-143148756 GTCTCCCGCTCTGGGCCTCTTGG + Intergenic
1049613791 8:143567707-143567729 GCCTCCCCCTGGGGGGCTGTGGG - Intronic
1049807749 8:144548546-144548568 CCCACCCCCTCGGGGGCTGTAGG + Intronic
1057337484 9:94166760-94166782 GCCTTCCGGCCGGCGCCTGTTGG + Intergenic
1058818402 9:108706563-108706585 ACCTCCTGCTCGGGGACTGATGG - Intergenic
1060202271 9:121658247-121658269 ACCTCCCTCTCGGGGCCACTTGG + Intronic
1061278214 9:129581683-129581705 GCCTCCCTCCTGGGTCCTGTGGG + Intergenic
1061664934 9:132155125-132155147 GCCTCCCGCTCGGGGCAGCAGGG - Intergenic