ID: 901693112

View in Genome Browser
Species Human (GRCh38)
Location 1:10986893-10986915
Sequence TTTGTAACTGACTGATCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901693112_901693114 1 Left 901693112 1:10986893-10986915 CCTCCTGATCAGTCAGTTACAAA No data
Right 901693114 1:10986917-10986939 ACACAAAATAACTAGATACTTGG No data
901693112_901693119 28 Left 901693112 1:10986893-10986915 CCTCCTGATCAGTCAGTTACAAA No data
Right 901693119 1:10986944-10986966 CTGAGAGGCAGAAGGTGAATGGG No data
901693112_901693118 27 Left 901693112 1:10986893-10986915 CCTCCTGATCAGTCAGTTACAAA No data
Right 901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG No data
901693112_901693116 20 Left 901693112 1:10986893-10986915 CCTCCTGATCAGTCAGTTACAAA No data
Right 901693116 1:10986936-10986958 TTGGTTGCCTGAGAGGCAGAAGG No data
901693112_901693115 13 Left 901693112 1:10986893-10986915 CCTCCTGATCAGTCAGTTACAAA No data
Right 901693115 1:10986929-10986951 TAGATACTTGGTTGCCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901693112 Original CRISPR TTTGTAACTGACTGATCAGG AGG (reversed) Intergenic
No off target data available for this crispr