ID: 901693118

View in Genome Browser
Species Human (GRCh38)
Location 1:10986943-10986965
Sequence CCTGAGAGGCAGAAGGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901693112_901693118 27 Left 901693112 1:10986893-10986915 CCTCCTGATCAGTCAGTTACAAA No data
Right 901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG No data
901693113_901693118 24 Left 901693113 1:10986896-10986918 CCTGATCAGTCAGTTACAAACAC No data
Right 901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901693118 Original CRISPR CCTGAGAGGCAGAAGGTGAA TGG Intergenic
No off target data available for this crispr