ID: 901696699

View in Genome Browser
Species Human (GRCh38)
Location 1:11012950-11012972
Sequence CCGCGGTGCCGCGTAGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 48}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901696685_901696699 20 Left 901696685 1:11012907-11012929 CCTGGCACGGGGAGGCCGGTGGC 0: 1
1: 0
2: 1
3: 27
4: 280
Right 901696699 1:11012950-11012972 CCGCGGTGCCGCGTAGCCTGAGG 0: 1
1: 0
2: 0
3: 4
4: 48
901696694_901696699 -4 Left 901696694 1:11012931-11012953 CCGAAACGGGGGGCCGGGCCCGC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 901696699 1:11012950-11012972 CCGCGGTGCCGCGTAGCCTGAGG 0: 1
1: 0
2: 0
3: 4
4: 48
901696691_901696699 5 Left 901696691 1:11012922-11012944 CCGGTGGCGCCGAAACGGGGGGC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 901696699 1:11012950-11012972 CCGCGGTGCCGCGTAGCCTGAGG 0: 1
1: 0
2: 0
3: 4
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901696699 Original CRISPR CCGCGGTGCCGCGTAGCCTG AGG Intronic