ID: 901700219

View in Genome Browser
Species Human (GRCh38)
Location 1:11041321-11041343
Sequence ATGGGTAGGTAGAAGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 791
Summary {0: 1, 1: 0, 2: 8, 3: 98, 4: 684}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901700219 Original CRISPR ATGGGTAGGTAGAAGGATGA TGG Intronic
900498693 1:2989126-2989148 ATGGGTAGATGGATGGATGGAGG - Intergenic
900498705 1:2989184-2989206 ATGGGTGGGTGGATGGATGGAGG - Intergenic
900509450 1:3051641-3051663 GTGGGTGGGTAGATGGGTGATGG - Intergenic
900546723 1:3233553-3233575 AGGGGCAGGGAGAAGGATGCTGG - Intronic
901317568 1:8318977-8318999 ATGGGTAGAAAGAAGCATGAGGG + Intronic
901699819 1:11039311-11039333 ATGGGTGGATGGAAGGATGGTGG + Intronic
901699960 1:11039973-11039995 ATGGGTGGGTGGATGAATGAGGG + Intronic
901700219 1:11041321-11041343 ATGGGTAGGTAGAAGGATGATGG + Intronic
902166524 1:14576346-14576368 ATAGATGGGTAGATGGATGATGG + Intergenic
902398004 1:16142926-16142948 ATGAGTAGATGGATGGATGAGGG + Intronic
902400046 1:16152637-16152659 CTGGGTGGGTAGAAGGACAAAGG + Intronic
903169157 1:21541479-21541501 GTCGCTAGGTGGAAGGATGATGG - Intronic
903224410 1:21886711-21886733 ATGGGTGGATAGATGGATGAAGG + Intronic
903277392 1:22230905-22230927 ATGAGTGGGTGGATGGATGATGG - Intergenic
903277442 1:22231099-22231121 ATGAGTGGGTGGATGGATGATGG - Intergenic
903510212 1:23869008-23869030 ATAAGGAGGTAGAGGGATGATGG + Intergenic
903578432 1:24353501-24353523 ATGGGTGGGTAGATGGTGGATGG + Intronic
904487969 1:30840116-30840138 ATGGGTGGGTGGATGGATGATGG + Intergenic
904933290 1:34107632-34107654 GTGGGTGGGTGGATGGATGAAGG + Intronic
905178932 1:36155227-36155249 CTGGGAAGGTGGATGGATGATGG - Intronic
905889330 1:41509752-41509774 AGGTGCAGGTAGAAGGAGGAGGG - Exonic
906751580 1:48267498-48267520 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
907111352 1:51929189-51929211 GTGGGGAGTTAGAGGGATGATGG - Intronic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
909594537 1:77391183-77391205 ATGGGCAGGTAGGATGATTATGG + Intronic
910310533 1:85819074-85819096 ATGGGGAGATATAAGGATCATGG + Intronic
910505108 1:87941619-87941641 ATGGCTAGGTAGAAAGATTCAGG + Intergenic
911130835 1:94386190-94386212 ATGGATGGGTAGAAGGGTGGTGG + Intergenic
911430028 1:97773781-97773803 ATGGGGAGCTAGAAGGGGGATGG - Intronic
912227791 1:107755121-107755143 ATGAGTATGTAGGGGGATGAGGG + Intronic
913967761 1:143391364-143391386 ATGGGCAGGTAGGAAGATGCTGG - Intergenic
914062139 1:144216954-144216976 ATGGGCAGGTAGGAAGATGCTGG - Intergenic
914117011 1:144749400-144749422 ATGGGCAGGTAGGAAGATGCTGG + Intergenic
914351293 1:146842712-146842734 ATGGGTGGGTGGGTGGATGATGG + Intergenic
914351329 1:146842863-146842885 ATGGGTGGGTAGGGAGATGATGG + Intergenic
914351353 1:146842947-146842969 ATGGGTGGGTGGGTGGATGATGG + Intergenic
914351361 1:146842974-146842996 ATGGGTGGGTGGATGGATGATGG + Intergenic
915447661 1:155983311-155983333 ATGGGAAGGAAGAAAGAGGAAGG + Intronic
917430203 1:174958888-174958910 ATGGATTGTTACAAGGATGAGGG + Intronic
919048162 1:192480347-192480369 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
920190312 1:204189674-204189696 CTGGGTAGTTATGAGGATGAAGG + Intergenic
920578208 1:207078843-207078865 ATGGGGAGGTTGAGGGAGGAGGG + Intronic
920654711 1:207867081-207867103 AAGGGTAACTAGAAGGATGGTGG - Intergenic
920700566 1:208215383-208215405 AGGGATGGGTAGATGGATGATGG + Intronic
920884250 1:209911161-209911183 ATGGGTGAATAGAAGGCTGAGGG + Intergenic
921736009 1:218629406-218629428 ATGGATAGGAAGAATGATTATGG - Intergenic
921969339 1:221129203-221129225 ATGGGAAGGAAGGAGGAGGAGGG + Intergenic
922745579 1:228041599-228041621 ATGGGTGGGTGGATAGATGATGG - Intronic
923301440 1:232644323-232644345 ATGGATAGATGGATGGATGAAGG - Intergenic
923307227 1:232699267-232699289 ATGGGCAGGGAAAAGGAGGAAGG + Intergenic
923415106 1:233749095-233749117 ATCAGTAGCTGGAAGGATGATGG + Intergenic
923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG + Intronic
924034274 1:239920310-239920332 ATGGATGGGTGGATGGATGATGG - Intergenic
924446819 1:244140591-244140613 TGGGGTAGGTGGATGGATGATGG - Intergenic
1062940150 10:1414883-1414905 ATGGTTAGATAGATGGATAAAGG + Intronic
1062940191 10:1415065-1415087 ATGGGTGGGTGGATGGATGGTGG + Intronic
1062940201 10:1415107-1415129 ATGGATGGGCAGAGGGATGATGG + Intronic
1063589157 10:7378836-7378858 ATGGGTGGGTAGGAGGCTGTTGG + Intronic
1064162217 10:12956443-12956465 ATGGGTAGGAAGAAGGGAGCAGG - Intronic
1064429578 10:15259113-15259135 ATAGATAGGGAGAATGATGATGG - Intronic
1065261061 10:23923602-23923624 ATGTGTCGGAAGAAGGAGGAAGG + Intronic
1065664537 10:28043468-28043490 ATGGGTAGGTTTGAGGAAGAAGG - Intergenic
1067925284 10:50502430-50502452 ATGGGCAGGTAGAAGGAACTGGG - Intronic
1068303228 10:55173347-55173369 ATGTGTATGTAGAAGGATGGGGG + Intronic
1069314914 10:67086120-67086142 ATGGATAGATAAATGGATGAAGG + Intronic
1069788961 10:71007218-71007240 TTGGATGGGTAGATGGATGATGG - Intergenic
1071541434 10:86487946-86487968 AGGGGTAGGTAGAGGGAAGGGGG + Intronic
1071957635 10:90777138-90777160 ATGGGAATTTAGAAGGATGTTGG - Intronic
1072519863 10:96221834-96221856 ATGGGTAGGTAATAGTAAGAAGG + Intronic
1072542508 10:96409174-96409196 ATGGATATGTGGATGGATGAGGG - Intronic
1073467381 10:103702057-103702079 ATGGATAGATGGATGGATGATGG - Intronic
1073529549 10:104218738-104218760 ATGGGGAGGGAAAAGGATGAGGG - Intronic
1074896342 10:117780711-117780733 ATGGGTGGATAGATGGATGGAGG - Intergenic
1075317228 10:121462605-121462627 ATGGGTTGGTAGCAGGGTAAAGG + Intergenic
1075902090 10:126051386-126051408 ATGGGTATATAAATGGATGATGG - Intronic
1076136770 10:128050426-128050448 ATGGATGGGTGGATGGATGATGG + Intronic
1076676780 10:132151265-132151287 GTGGATAGGTGGAAGGATAAAGG - Intronic
1076768305 10:132649691-132649713 ATGCGTGGGTAGGGGGATGATGG + Intronic
1076867378 10:133174733-133174755 ATGGATGGGTGGATGGATGATGG + Intronic
1077150225 11:1069852-1069874 ATGGATAGGTGGATGGATGGAGG - Intergenic
1077159454 11:1106100-1106122 CTAGGTAGGTGGAAGGATGGAGG - Intergenic
1077319138 11:1933218-1933240 ATGGATAGGTAGATGGGTGGAGG - Intronic
1078978508 11:16505123-16505145 AGAGGAAGGTAGAAAGATGAGGG + Intronic
1079336550 11:19575296-19575318 ATGGGCAGGTGGAAGCATGCTGG + Intronic
1079367107 11:19819054-19819076 GTGGGTGGGTAGATGGATGAAGG - Intronic
1079657484 11:23000930-23000952 GTGGGTAGGTGGAGGAATGACGG - Intergenic
1080667920 11:34352025-34352047 CTGGGTAGTCTGAAGGATGAGGG - Intronic
1080849334 11:36054767-36054789 ATGGATAGATGGATGGATGATGG + Intronic
1081206444 11:40281022-40281044 ATGGGGAGGACTAAGGATGAAGG + Intronic
1081626491 11:44659063-44659085 ATGGAGAGATGGAAGGATGAAGG + Intergenic
1081629960 11:44682340-44682362 ATGGGTGGATGGATGGATGATGG - Intergenic
1081738341 11:45420805-45420827 ATGGGTAGATAGGTGGATGACGG - Intergenic
1081836911 11:46163330-46163352 AGGGGTAGGTAGGAGCATGAGGG - Intergenic
1081866802 11:46364753-46364775 TTGGGCAGGAGGAAGGATGAAGG - Intronic
1082142782 11:48629751-48629773 ATGGATAGGAAGAAGGATCCAGG - Intergenic
1082692034 11:56317840-56317862 ATGGGTAGATAGATAGATTATGG - Intergenic
1083201252 11:61122356-61122378 GTGGGTGGGTGGATGGATGATGG + Intronic
1083634773 11:64114569-64114591 ATGGACAGGTAGATGCATGATGG + Intronic
1084445051 11:69198766-69198788 ATGGAGAGATGGAAGGATGAAGG - Intergenic
1084461884 11:69300800-69300822 ATGAGTGGGTGGATGGATGAAGG + Intronic
1084494982 11:69498341-69498363 ATGTGTAGGTGGAAGGGTGCAGG + Intergenic
1084495080 11:69498721-69498743 GTGGGTAGGTGGAGGGATGGAGG + Intergenic
1084543901 11:69804223-69804245 ATGGATGGATAGATGGATGATGG + Intergenic
1084596322 11:70119011-70119033 ATGGGTGGGTGGATGGATGATGG + Intronic
1084596357 11:70119173-70119195 ATGGGTGGGTGGATGGGTGATGG + Intronic
1084596366 11:70119214-70119236 ATGGGTGGGTGGAGGAATGATGG + Intronic
1084596371 11:70119237-70119259 ATGGATGGGTTGATGGATGATGG + Intronic
1084596393 11:70119309-70119331 ATGGGTGGGTGGATGGATGATGG + Intronic
1084596401 11:70119350-70119372 ATGGGTGGGTGGATGAATGATGG + Intronic
1084596406 11:70119373-70119395 ATGGATGGGTTGATGGATGATGG + Intronic
1084596508 11:70119891-70119913 ATGGGTGGGTAGATGGATGATGG + Intronic
1084609817 11:70194932-70194954 ATGGGTGGGTAGATGGTAGATGG + Intergenic
1084684561 11:70686099-70686121 ATGGATGGGTAGATGGGTGATGG - Intronic
1084684617 11:70686310-70686332 ATGGATGGGTAGATGGATGATGG - Intronic
1084684637 11:70686405-70686427 ATGGATGGGTAGATGGATGATGG - Intronic
1084705130 11:70811684-70811706 ATGGATGGGTAGATGGATGTTGG - Intronic
1084705150 11:70811798-70811820 ATGGATGGGTAGATGGATGATGG - Intronic
1084773456 11:71359122-71359144 ATGGGTGAATAGAAAGATGATGG - Intergenic
1084781802 11:71414776-71414798 ATGGGTGGGTAGATGGATGATGG + Intergenic
1084781845 11:71414982-71415004 ATGGATGGGTAGATGGATGATGG + Intergenic
1084785637 11:71440319-71440341 ATGGGTAAATGGATGGATGACGG + Intronic
1085406878 11:76268703-76268725 ATGGGTGGATGGATGGATGATGG - Intergenic
1087158930 11:94930342-94930364 ATGGGGAGGTGGGAGAATGAAGG + Intergenic
1087387194 11:97486603-97486625 ATGGGTACGTATACGGATCATGG + Intergenic
1087697017 11:101391110-101391132 ATCAGTAGGTAGAGGGATAAGGG + Intergenic
1088295004 11:108283415-108283437 ATGTTTAGGTATCAGGATGATGG + Intronic
1088709015 11:112489835-112489857 ATGGATGGATAGATGGATGATGG - Intergenic
1090554123 11:127855597-127855619 ATGGGGAGCTAGAAAGAGGATGG + Intergenic
1090748439 11:129725792-129725814 ATGGGTGGGCAGGAGGATGGTGG - Intergenic
1091187354 11:133658452-133658474 ATGGGTAGATGGATGAATGATGG + Intergenic
1091593112 12:1857098-1857120 ATGTGTAGGAAGAAGGAAGAAGG + Intronic
1092125137 12:6069902-6069924 ATGGACAGTTGGAAGGATGATGG + Intronic
1092818351 12:12330570-12330592 ATTGGTGGGTAGAAGGGTGGCGG + Exonic
1092923217 12:13250868-13250890 ATGGCTAGAGAGAAGAATGAAGG + Intergenic
1093070231 12:14700867-14700889 ATGGGAAGGAAGAAAGATCAGGG + Intergenic
1093531957 12:20176079-20176101 TTGGGGAGGAAGAAGGATGAAGG - Intergenic
1096527413 12:52219417-52219439 ATGGATAGATAGATAGATGATGG - Intergenic
1096848768 12:54422022-54422044 ATGGAGAGGAAGAAGGGTGAAGG + Intergenic
1097240962 12:57575003-57575025 ATGGGTAGGTAGAAGGTGGGAGG + Intronic
1100043208 12:90345516-90345538 ATGAGCAGGTAGAAGAATGAGGG + Intergenic
1100837283 12:98578246-98578268 ATGGGTAGGTGGATGGGTGGAGG + Intergenic
1102041329 12:109802807-109802829 ATGGATAGATGGATGGATGAAGG - Intronic
1102043164 12:109813822-109813844 ATGGACAGATGGAAGGATGATGG + Intronic
1102394148 12:112573912-112573934 GTGGGTAGGGAGACGGGTGATGG + Intronic
1102504242 12:113373827-113373849 ATGGGTAGATGGATGGATGATGG - Intronic
1102507076 12:113390419-113390441 ATGGATAGGTAGGTGGATGGAGG - Exonic
1102856098 12:116295464-116295486 ATGGATGGGTAGATGGATGGAGG + Intergenic
1102856099 12:116295468-116295490 ATGGGTAGATGGATGGAGGATGG + Intergenic
1102856117 12:116295545-116295567 ATGGGTGGGTGGATGGATAATGG + Intergenic
1102894442 12:116587478-116587500 ATGGGTAGCTAGATGGATGAAGG - Intergenic
1102988423 12:117297376-117297398 TTGGGTAAGTGGAAGGATGGTGG + Intronic
1103012784 12:117470068-117470090 ATGGGTGGATGGATGGATGAAGG - Intronic
1103012814 12:117470277-117470299 ATGGGTGGATGGATGGATGAAGG - Intronic
1103023991 12:117558687-117558709 ATGGATGGGTAGATGGATGGGGG + Intronic
1103444827 12:120987997-120988019 GTGGGTGGGTAGATGGATGATGG - Intronic
1103444843 12:120988060-120988082 GTGGGTGGGTGGATGGATGATGG - Intronic
1103444860 12:120988123-120988145 GTGGGTGGGTGGATGGATGATGG - Intronic
1103444877 12:120988186-120988208 GTGGGTGGGTAGATGGATGATGG - Intronic
1103444893 12:120988249-120988271 GTGGGTGGGTGGATGGATGATGG - Intronic
1104034688 12:125090140-125090162 ATGGATAGATGGATGGATGATGG - Intronic
1104092296 12:125526943-125526965 ATGGGTGGATAGAAGGGTGGTGG - Intronic
1104179075 12:126360705-126360727 ACTGGTGGGGAGAAGGATGAGGG + Intergenic
1104295494 12:127508151-127508173 ATGGGTAGGAGGATGGAGGATGG + Intergenic
1104778430 12:131404735-131404757 GTGGGTGGGTGGATGGATGATGG - Intergenic
1104778450 12:131404809-131404831 ATGGGTGGATGGATGGATGATGG - Intergenic
1104778506 12:131405026-131405048 ATGGGTGGATGGATGGATGATGG - Intergenic
1104778535 12:131405139-131405161 ATGGGTGGATGGATGGATGATGG - Intergenic
1104778550 12:131405194-131405216 ATGGGTGGGTGGATGGATGATGG - Intergenic
1104778581 12:131405310-131405332 ATGGGTGGATGGATGGATGATGG - Intergenic
1104778630 12:131405470-131405492 ATGGATGGGTGGATGGATGATGG - Intergenic
1104779310 12:131409681-131409703 ATGGGTGGATAGATGGATGATGG - Intergenic
1104813973 12:131635343-131635365 ATGAGAAGGTAGATGGATGATGG - Intergenic
1104896088 12:132164541-132164563 GTGGGTGGGTGGACGGATGATGG - Intergenic
1104896102 12:132164584-132164606 ATGGCTAGGTAGACGGATGATGG - Intergenic
1104896220 12:132166305-132166327 ATGGCTGGGTGGATGGATGATGG - Intergenic
1104896271 12:132166523-132166545 ATGGCTGGGTGGATGGATGATGG - Intergenic
1104896389 12:132166959-132166981 ATGGATGGGTAGGTGGATGATGG - Intergenic
1104896432 12:132167125-132167147 ATGGGTGGGTGGATGGATGATGG - Intergenic
1105249011 13:18679293-18679315 ATGGATAGTTAGATGGATAAGGG + Intergenic
1105279610 13:18955767-18955789 ATGGATGGGTAGATGGATGGGGG - Intergenic
1105279828 13:18956988-18957010 ATGGGTAGATGGATGGATCATGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1105552636 13:21411721-21411743 TAGGGTAGCTAGAAGAATGACGG + Intronic
1106812758 13:33376405-33376427 ATGGGAAGGCAGCAGGTTGAAGG + Intergenic
1106900583 13:34351269-34351291 ATGGATGAGTAGAGGGATGATGG + Intergenic
1107539331 13:41371493-41371515 TTGGGTAGGCTGAAGGGTGAAGG - Intronic
1108962448 13:56251673-56251695 ATGGGTAGGGAGGATGGTGATGG - Intergenic
1109447472 13:62461195-62461217 ATAGATAGGTAGATGGATGTAGG - Intergenic
1109606528 13:64704969-64704991 AGGGGTTTGCAGAAGGATGAAGG + Intergenic
1110310626 13:74044990-74045012 ATAGGTAGGTAGATAGATAAGGG + Intronic
1110964907 13:81681478-81681500 ATGGTTAGGTAGCAGGCTGCGGG + Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1112628880 13:101138959-101138981 AACGGTAGGTAGCAGGATAAAGG + Intronic
1112657539 13:101467618-101467640 AAGGCTGGGTAGAAGAATGAGGG + Intronic
1112729238 13:102341381-102341403 ATGGGTAGATGAATGGATGATGG - Intronic
1113374106 13:109748065-109748087 ATGGGGTGGTAGAAGGCAGAAGG + Intergenic
1113780263 13:112972741-112972763 ATGGGTGGGTGGATGGATGGAGG + Intronic
1114756969 14:25270203-25270225 ATGGGTAGATAGGAAGATGGTGG - Intergenic
1115620118 14:35132837-35132859 AAGGGAAGGAAGAAGGAAGAAGG + Intronic
1115808823 14:37082656-37082678 ATGGGTGGGGAAAAGGAAGAAGG - Intronic
1117258235 14:54002191-54002213 ATGGGCAGCTGGAAGGATCATGG - Intergenic
1117508926 14:56429405-56429427 AGGGGCAGGTAAAAGGAAGAGGG - Intergenic
1117610027 14:57473659-57473681 AGGGGAAAGTAAAAGGATGAAGG - Intronic
1118532680 14:66724547-66724569 AGGGGTAGATAGAGGGATGCAGG + Intronic
1118722247 14:68602471-68602493 GTGGGTGGGTGGATGGATGATGG + Intronic
1119206615 14:72799175-72799197 ATGGGTTGATGGAAGGATGGAGG - Intronic
1119345515 14:73920474-73920496 CTGGGTAGGTAGAATGGAGACGG + Intronic
1119997651 14:79271382-79271404 AGGGGAAGGAAGAAGGAGGAAGG - Intronic
1120045138 14:79797313-79797335 AGGAGTAGGTAGAGGGAAGAGGG + Intronic
1120280463 14:82431747-82431769 ATGGGAAGGCAGAAGGGGGATGG + Intergenic
1120852581 14:89184810-89184832 ATAGGATGGCAGAAGGATGACGG - Intronic
1121604862 14:95233316-95233338 ATGGGTGGATGGAGGGATGATGG - Intronic
1121816023 14:96929164-96929186 ATGGATAGGTCGATGGATGGGGG - Intronic
1121816030 14:96929187-96929209 ATGGTTAGGTAGATGGATGGGGG - Intronic
1121816038 14:96929211-96929233 ATAGATAGGTAGATGAATGAAGG - Intronic
1121816050 14:96929282-96929304 ATGGATAGGTAGATGGATAGGGG - Intronic
1122011124 14:98749078-98749100 ATGGATAGATAGATAGATGATGG + Intergenic
1122252798 14:100452003-100452025 ATGGATAGTTGGATGGATGATGG - Intronic
1122322242 14:100862073-100862095 AGGGGGAGGGAGAAGGAGGAAGG - Intergenic
1122546011 14:102523285-102523307 AGGGGAAGGGAGAAGGAGGAAGG + Intergenic
1122600722 14:102920394-102920416 ATGGATGGGTAGATGGATGGTGG - Intergenic
1122879911 14:104686051-104686073 ATGGGCAGATGGATGGATGAGGG + Intergenic
1122879931 14:104686132-104686154 GTGGATGGGTAGATGGATGAAGG + Intergenic
1122958315 14:105083072-105083094 ATGGGTGGATGGATGGATGATGG - Intergenic
1122958337 14:105083153-105083175 ATGGGTGGATGGATGGATGATGG - Intergenic
1123058837 14:105585360-105585382 ATGGGTGGGTAGGCGGATGGAGG - Intergenic
1123083163 14:105705582-105705604 ATGGGTAGGCGGATGGAGGATGG - Intergenic
1123893541 15:24805150-24805172 ATAGGTAGGTAGAAGAAAAATGG + Intergenic
1126386567 15:48099579-48099601 ATGGGTAGGCAGAAGGAGAAGGG - Intergenic
1127027633 15:54824997-54825019 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1128568615 15:68717429-68717451 ATAGGTGGGGAGAAGGAAGACGG + Intronic
1128793557 15:70449691-70449713 ATGGGTGGTTAGAGGGATGGAGG + Intergenic
1128793626 15:70449903-70449925 ATGGGTGGATAGAGGGATGGAGG + Intergenic
1128793679 15:70450087-70450109 ATGGGTGGACAGAGGGATGAGGG + Intergenic
1128793684 15:70450134-70450156 ATGAGTGGATAGAAGGATGGAGG + Intergenic
1128793748 15:70450360-70450382 ATGGGTGGATGGAGGGATGAAGG + Intergenic
1129118371 15:73379358-73379380 ATGGGAAGGTAGAAGAGTGATGG - Intergenic
1129170714 15:73805879-73805901 ATGGGTGGGTAGATGAGTGAAGG - Intergenic
1129332048 15:74832719-74832741 ATGGGGAGGGGGAAGGAAGAAGG - Intergenic
1130353648 15:83111488-83111510 ATGGATAGATGGATGGATGATGG - Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130430447 15:83842050-83842072 ATGGGAAGGCAGAAGGGGGATGG - Intronic
1132164417 15:99571725-99571747 AGGGGTAGGAAGAAGGTTGGGGG - Intronic
1132358493 15:101191874-101191896 GTGAGTAGATAGATGGATGAAGG - Intronic
1132644833 16:994055-994077 ATGGGTGGGTGGATGGATGGGGG - Intergenic
1132653923 16:1033813-1033835 ATGGATGGATAGATGGATGATGG - Intergenic
1133909994 16:10057009-10057031 ATGGATGGGTAGAAGGCTGGAGG - Intronic
1134106984 16:11492310-11492332 ATGGGTGGGTGGATGGATGATGG - Intronic
1134224406 16:12380392-12380414 GTGGGTGGGTGGATGGATGAGGG - Intronic
1134224564 16:12380881-12380903 GTGGGTAGGTGGATGGATGGTGG - Intronic
1134224681 16:12381226-12381248 GTGGATAGGTAGATGGATGAGGG - Intronic
1134224702 16:12381298-12381320 GTGGGTGGGTAGATGGATAATGG - Intronic
1134224733 16:12381414-12381436 ATGGGTGGGTGGGTGGATGATGG - Intronic
1134224741 16:12381437-12381459 ATGGGTGGGTAGATGAATGATGG - Intronic
1134224745 16:12381456-12381478 GTGGATAGGTGGATGGATGATGG - Intronic
1134224769 16:12381533-12381555 GTGGATAGGTGGATGGATGATGG - Intronic
1134224790 16:12381607-12381629 GTGGGTGGGTGGATGGATGATGG - Intronic
1134224857 16:12381822-12381844 ATGGGTGAGTGGATGGATGATGG - Intronic
1134224876 16:12381899-12381921 TGGGGTGGGTAGATGGATGACGG - Intronic
1134262443 16:12662889-12662911 ATGGGTTTGCAGAAGGATAATGG - Exonic
1134834965 16:17353648-17353670 ATGGGTAGAGAGATGCATGATGG - Intronic
1135086494 16:19478794-19478816 ATGGGTAAATGGATGGATGATGG - Intronic
1135629368 16:24023780-24023802 ATGGGTAAGTGGAAGGTTGGGGG - Intronic
1135793647 16:25421485-25421507 CTGGGCAGGGAGAAGGAAGAGGG + Intergenic
1136071358 16:27789417-27789439 ATGGATAGATGGAGGGATGATGG + Exonic
1136071417 16:27789822-27789844 ATGGGTGGATGGATGGATGAAGG + Exonic
1136107415 16:28040103-28040125 ATGGGTGTGGAGAAGGGTGACGG - Intronic
1136279085 16:29197554-29197576 ATGGGTGGGTGGATGTATGACGG + Intergenic
1136279091 16:29197589-29197611 ATGGGTGGGTGGATGTATGATGG + Intergenic
1136865405 16:33747445-33747467 AGCGGAAGTTAGAAGGATGAGGG - Intergenic
1137511996 16:49108899-49108921 GTGGGGAGGAGGAAGGATGATGG - Intergenic
1137579736 16:49626700-49626722 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579754 16:49626775-49626797 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579771 16:49626850-49626872 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579781 16:49626892-49626914 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579793 16:49626951-49626973 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579802 16:49626986-49627008 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579819 16:49627061-49627083 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579829 16:49627103-49627125 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579857 16:49627229-49627251 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579868 16:49627276-49627298 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579879 16:49627323-49627345 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579891 16:49627374-49627396 ATGGATAGGTAGATGGAGGATGG - Intronic
1137579901 16:49627418-49627440 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579924 16:49627524-49627546 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579935 16:49627568-49627590 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579959 16:49627688-49627710 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580000 16:49627866-49627888 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580017 16:49627941-49627963 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580028 16:49627985-49628007 ATGGATAGGTAGATGGAGGATGG - Intronic
1137580038 16:49628032-49628054 ATGGATGGGTAGATGGAAGATGG - Intronic
1137580061 16:49628135-49628157 ATGGATGGGTAGATGGACGATGG - Intronic
1137580075 16:49628194-49628216 ATGGGTGGGTAGATGAAGGATGG - Intronic
1137580097 16:49628316-49628338 ATGCGTGGGTAGATGGAAGATGG - Intronic
1137580101 16:49628339-49628361 ATGGGTGGGTAGATAGAGGATGG - Intronic
1137661724 16:50212969-50212991 ATCTGTAGGTAGACAGATGATGG - Intronic
1137798899 16:51244661-51244683 TTGGGTAGGCAGATGGGTGAAGG - Intergenic
1137832575 16:51558047-51558069 ATGGGGAGGGGGGAGGATGAGGG + Intergenic
1138495712 16:57408002-57408024 ATGGGTAGATGGATGGATGGAGG - Intronic
1139982685 16:70872603-70872625 ATGGGTGGGTGGGTGGATGATGG - Intronic
1139982709 16:70872687-70872709 ATGGGTGGGTAGGGAGATGATGG - Intronic
1140067681 16:71625363-71625385 ATGGGTGGGTGGATGGATGGTGG + Intergenic
1140339112 16:74139790-74139812 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1140507059 16:75480126-75480148 GTGGGTAGGTAGAACTAAGAAGG - Intronic
1140979405 16:80092487-80092509 ATGGGTGGGTAGATGGGGGATGG - Intergenic
1141031879 16:80596311-80596333 ATGGATGGATAAAAGGATGATGG + Intergenic
1141083737 16:81076910-81076932 AAGGGTGGGTAGACGGAGGACGG - Intronic
1141110107 16:81265336-81265358 ATGGGTGGGTAGATGGATAGTGG - Intronic
1141110201 16:81265693-81265715 ATGGGTAGGTAGATGGATGGTGG - Intronic
1141178356 16:81735318-81735340 ATGGATAGATAGATGGATGATGG + Intergenic
1141421528 16:83920982-83921004 ATGGATGGGTGGAAGGAAGATGG + Exonic
1141421570 16:83921172-83921194 ATGGGTGGATGGAAGGAAGATGG + Exonic
1141483706 16:84324825-84324847 ATGGGTGGGTAGATGGATGGAGG - Intronic
1141483829 16:84325575-84325597 ATGGGTGGGTGGATGGATGGTGG - Intronic
1141641874 16:85346331-85346353 ATGGGCAGGTAGATGGATGGTGG + Intergenic
1141641994 16:85346840-85346862 ATGGGCAGGTGGATGGGTGATGG + Intergenic
1141641998 16:85346859-85346881 ATGGACAGGTAGATGGATGGTGG + Intergenic
1141852721 16:86658468-86658490 GTGGGCAGGTAGAAAGATGAAGG - Intergenic
1141854894 16:86674102-86674124 ATGAATGGGTAGATGGATGAAGG - Intergenic
1141899308 16:86980104-86980126 ATGGGTAGGTAGAAAGAAAAAGG + Intergenic
1142083484 16:88163682-88163704 ATGGGTGGGTGGATGTATGATGG + Intergenic
1142152218 16:88517623-88517645 ATAGGTGGGTAGATGGATGGTGG + Intronic
1142152859 16:88520439-88520461 ATAGGTGGGTAGATGGATGGTGG + Intronic
1203126769 16_KI270728v1_random:1593701-1593723 AGCGGAAGTTAGAAGGATGAGGG - Intergenic
1142779645 17:2171437-2171459 CTGGGTAGAAAGAAGGATTACGG + Intronic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1143616269 17:8051873-8051895 ATGGGGCAATAGAAGGATGAAGG - Intergenic
1144063243 17:11601788-11601810 ATGGGGAGGTGGAAGGAAAAGGG - Intronic
1145981090 17:29012088-29012110 ATTGGGAGGTAGTAGGGTGAAGG - Intronic
1146006282 17:29162740-29162762 ATGGGCAGGTGGAAGGATGATGG + Intronic
1146095080 17:29922096-29922118 ATAGTTAGGTAGAGAGATGAGGG + Intronic
1146459010 17:33029050-33029072 GTGGGAAGGGTGAAGGATGAGGG + Intronic
1146584676 17:34071908-34071930 ATGTCTAAGTGGAAGGATGAAGG + Intronic
1146820913 17:35983033-35983055 ATGTGTGGATGGAAGGATGAAGG - Intergenic
1147666316 17:42150865-42150887 ATGGGTAGGTAGGGGTTTGAAGG - Intronic
1148346110 17:46904498-46904520 ATGGGTGGCTGGACGGATGATGG + Intergenic
1148678363 17:49458285-49458307 ATGGGTAGCCTGAAGGATGTGGG - Intronic
1149242412 17:54665479-54665501 ATGGGTAGGTTGAAGAGAGAGGG + Intergenic
1149453747 17:56770610-56770632 ATGGATGGATAGATGGATGATGG - Intergenic
1150320426 17:64209013-64209035 ATGGATGGGTAGATGAATGAAGG - Intronic
1150789657 17:68193118-68193140 AAGGGTAGGGAAAAGGAGGATGG - Intergenic
1151449655 17:74190603-74190625 ATGAGTAGGTAGAGGAGTGAAGG - Intergenic
1151511821 17:74565464-74565486 ATGGGTGGGTAGATGAAAGATGG - Intergenic
1151615363 17:75206673-75206695 CAGGGTAGGTAGAGGGATTATGG + Intronic
1152374925 17:79914063-79914085 ATGGGTGGTAAGAATGATGATGG + Intergenic
1152473559 17:80503515-80503537 ATGGGTAGATAGGTGGATGGAGG + Intergenic
1152473753 17:80504248-80504270 ATGGGTGGATGGAGGGATGATGG + Intergenic
1153930368 18:9873411-9873433 GTGGGTTTGCAGAAGGATGAGGG + Intergenic
1153942266 18:9988609-9988631 AAGTGTTGATAGAAGGATGAAGG - Intergenic
1154439870 18:14379936-14379958 ATGGATAGTTAGATGGATAAGGG - Intergenic
1155582971 18:27332569-27332591 ATGGGTGGGGAGAAGGCGGATGG - Intergenic
1156194742 18:34761465-34761487 ATGGGTAGGGAAAAGGTGGAAGG + Intronic
1156491987 18:37501714-37501736 GTAGGTAGGAAGAAGGAGGAGGG + Intronic
1157300000 18:46472456-46472478 ATGGGTAGGTGGGTGGATGGGGG - Intergenic
1157311483 18:46556633-46556655 GTGGGCAGGTATGAGGATGAGGG - Intronic
1157484395 18:48076643-48076665 ATGGGCAGGGAGCAGGGTGAGGG + Intronic
1157831101 18:50857752-50857774 ATTTATAGGTAGGAGGATGATGG - Intergenic
1157945317 18:51972866-51972888 AAGAGTAGGTATAAGGGTGAGGG + Intergenic
1158574281 18:58623159-58623181 CTGGCTGGGTTGAAGGATGAGGG - Intronic
1159754222 18:72343680-72343702 AGGGGTAGGGGGAAGGATGGAGG + Intergenic
1159923387 18:74246717-74246739 ATGGGGAGATAGCAGGAGGATGG - Intergenic
1160016149 18:75142080-75142102 ATAGGTAGCTGGAAGGATGTAGG + Intergenic
1160288847 18:77572023-77572045 ATGTGCATGTAGAAGGATGGAGG + Intergenic
1160367811 18:78343771-78343793 TTGGGTAGGTAAAAGGAAGAAGG - Intergenic
1160687129 19:442328-442350 ATGGGTGGGTGGATGGATGGAGG + Intronic
1160687365 19:443067-443089 ATGGGTGGGTGGATGGATGGAGG + Intronic
1160692430 19:466161-466183 ATGGTTAGGTAGATGGTAGATGG + Intronic
1160692456 19:466252-466274 ATGGTTAGGTAGATGGTGGATGG + Intronic
1160692521 19:466493-466515 ATGGTTAGGTAGATGGTGGATGG + Intronic
1160709562 19:544806-544828 ATGGGTAGAGGGATGGATGATGG - Intronic
1160977805 19:1802322-1802344 ATGGGTGGGTGGATGGATGTGGG - Intronic
1161105282 19:2440782-2440804 ATGAGTAGATGGATGGATGATGG - Intronic
1161227674 19:3154644-3154666 ATGGGTGGGTGGATGGATGATGG + Intronic
1161287293 19:3475445-3475467 GTGGGTGGGTGGATGGATGATGG + Intronic
1161287572 19:3476892-3476914 GTGGGTGGGTGGATGGATGATGG + Intronic
1161347723 19:3776504-3776526 ATGGGTATGTGGATGGATGATGG + Intergenic
1161422747 19:4184773-4184795 ATGGGTGGGTGGATGGATGGGGG + Intronic
1161449133 19:4334870-4334892 ATGAGTAGGTGGATGGATGGAGG - Intronic
1161449153 19:4334951-4334973 ATGAGTGGGTGGATGGATGATGG - Intronic
1161449198 19:4335151-4335173 ATGAGTAGGTGGATGGATGATGG - Intronic
1161449213 19:4335220-4335242 ATGAGTAGGTGGATGGATGATGG - Intronic
1161681463 19:5681764-5681786 ATGGGTGGATGGATGGATGATGG - Intronic
1161718909 19:5892571-5892593 ATGGGAAGGAAGGGGGATGAGGG + Exonic
1161916067 19:7229154-7229176 ATGGGTGAGTGGATGGATGATGG + Intronic
1162085816 19:8248562-8248584 ATGGGTGGACAGATGGATGATGG + Intronic
1162085825 19:8248597-8248619 ATGGGTAGGTGGATGGATGATGG + Intronic
1162085882 19:8248854-8248876 ATGGGTGGGTGGATGGATGGTGG + Intronic
1162085912 19:8249017-8249039 ATGGGTGGATGGATGGATGATGG + Intronic
1162178182 19:8847249-8847271 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1163238382 19:16043222-16043244 ATGGATGGGTGGATGGATGAAGG + Intergenic
1163238464 19:16043532-16043554 ATGGATGGGTGGATGGATGAAGG + Intergenic
1163462143 19:17445426-17445448 GTGGGCAAGTAGATGGATGATGG - Intronic
1163685618 19:18710222-18710244 CTGGGTGGGTAGATGGAGGAAGG - Intronic
1164678878 19:30120987-30121009 ATGGGTAGGTGGATGGATGATGG - Intergenic
1164827214 19:31292640-31292662 ATGGATGGGTAGATGGATGGAGG - Intronic
1165144298 19:33721642-33721664 GTGGGTGGGTAGATGGATGGAGG + Intronic
1165190314 19:34057442-34057464 ATGGGTAGATGGATGGATGATGG + Intergenic
1165843095 19:38801144-38801166 ATGGATGGGTAGATGGATAAAGG + Intergenic
1166069026 19:40377025-40377047 ATGGGCAGGTAGAGGGGTCAGGG + Intronic
1166356214 19:42229089-42229111 ATGGGGTGGTAGAAGGGTGAGGG + Intergenic
1167144075 19:47671796-47671818 ATGGGTAGCTAGATGGATGGAGG + Intronic
1167598194 19:50438270-50438292 ATGGGTAGGTGGATGGATAACGG + Intronic
1167783203 19:51614074-51614096 ATGGGTAGGGATATGGGTGAAGG - Intronic
1168086896 19:54054769-54054791 GTAGGTAGATAGATGGATGAAGG + Intronic
1168330909 19:55567961-55567983 ATGGATAGGTGAATGGATGATGG + Intergenic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
1168464937 19:56594825-56594847 AGGGGTTGGAAGAAGGATGGAGG - Intergenic
1168508273 19:56954608-56954630 ATGGGTGGATAGATGGAGGATGG - Intergenic
1202701548 1_KI270712v1_random:168832-168854 ATGGGCAGGTAGGAAGATGCTGG - Intergenic
924996233 2:364450-364472 ATGGGTAGGGAGATGGCTGGAGG + Intergenic
925260169 2:2521912-2521934 ATGGGTAGATAAATGGATGGAGG - Intergenic
925738571 2:6985469-6985491 ATGAGTAAGTGGAAGGATTAGGG + Intronic
925745358 2:7039144-7039166 ATGGATAGAGAGATGGATGATGG + Intronic
925925714 2:8668532-8668554 ATGGATGGGTGGATGGATGAGGG + Intergenic
926105444 2:10146721-10146743 AAGGGTAGGGAGGAGGAGGAGGG + Intronic
926550271 2:14293208-14293230 AAGGGCATGTAGAAGGATAATGG + Intergenic
927474924 2:23405886-23405908 ATGGGTAGGTGTAAGGAAGAGGG + Intronic
927521435 2:23701108-23701130 ATGGGAAGGTTGAGGGAGGAGGG - Intronic
928068215 2:28188210-28188232 ATGTGTAGGTAGAATGGAGAAGG - Intronic
929264552 2:39903519-39903541 ATGAGAAGATAGATGGATGAGGG + Intergenic
930101719 2:47608584-47608606 ATTGGTTGGAAGAAGGACGATGG - Intergenic
931926052 2:67073734-67073756 TTGGGCAGGTGGAAGGAGGAAGG - Intergenic
932697372 2:73968234-73968256 CTGGGTGGCTGGAAGGATGATGG - Intergenic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
934172465 2:89552279-89552301 ATGGGCAGGTAGGAAGATGCTGG - Intergenic
934282778 2:91626631-91626653 ATGGGCAGGTAGGAAGATGCTGG - Intergenic
934633925 2:95964303-95964325 AGTGGAAGTTAGAAGGATGAGGG - Intronic
934799702 2:97140931-97140953 AGTGGAAGTTAGAAGGATGAGGG + Intronic
935023299 2:99252577-99252599 ATGGATAGTTGGATGGATGAAGG + Intronic
935206485 2:100901097-100901119 ATGGGGAGGTAGAAGGAGGGAGG - Intronic
935494667 2:103765419-103765441 GTGTGTGGGCAGAAGGATGAGGG - Intergenic
936451373 2:112636217-112636239 ATGGGTAGGAAGAAAAAGGAAGG + Intergenic
936956991 2:118032435-118032457 ATGGGTGGATGGATGGATGAAGG + Intergenic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
939783880 2:146484187-146484209 ATGAGTAGGGAGAAGGGAGAAGG + Intergenic
939870889 2:147524620-147524642 AAGGGTAGCTAGAAGGAGGAAGG + Intergenic
940258011 2:151752422-151752444 AGGAGTATTTAGAAGGATGAGGG - Intergenic
943612291 2:190047286-190047308 ATGGGAAAGAAGAAGGAAGAAGG - Intronic
943774375 2:191749631-191749653 AGAGGTAGGAAGAAGAATGAGGG - Intergenic
944537619 2:200726512-200726534 ATGGATGGGTGGATGGATGATGG - Intergenic
945670304 2:212794317-212794339 ATGAGTAGGTAGGAGGGTTAAGG + Intergenic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
947129167 2:226903988-226904010 ATGGGGAGGTGGAAGAAGGATGG - Intronic
947291516 2:228580808-228580830 ACGGGTAGGTAGAATGGGGAAGG + Intergenic
947382543 2:229559212-229559234 ATGGGTAGTTAGAAACATCATGG + Intronic
948375472 2:237517813-237517835 ATGGATGGGTAGATGAATGAAGG + Intronic
948375509 2:237517999-237518021 ATGGGTGGGTGCATGGATGAAGG + Intronic
948900001 2:240951415-240951437 ATGGGTGGATAGAGAGATGATGG - Intronic
949065863 2:241990054-241990076 ATGGGTGGATGGATGGATGATGG - Intergenic
1169726689 20:8741390-8741412 ATGAGTAAGTAGATGAATGATGG + Intronic
1169892338 20:10466665-10466687 ATGGGTGGGAAGAAAGAGGAGGG - Intronic
1171249041 20:23634862-23634884 GTGGGTAGATAGATGTATGAGGG - Intronic
1171988876 20:31680285-31680307 TTGGGTAGGTGAAAGGGTGAAGG - Intronic
1172203989 20:33148968-33148990 ATGAGTAGGTAGATGGATGGAGG + Intergenic
1172780850 20:37436274-37436296 ATGGGTGGGTGGATGCATGACGG - Intergenic
1172976133 20:38907413-38907435 ATAGGTAGATAGATGGATGAAGG + Intronic
1173285760 20:41670274-41670296 ATAGGTAGGGGGAAGGATGCTGG + Intergenic
1173502974 20:43566885-43566907 GTGGGTGGGTAGAAGGAGGGAGG + Intronic
1173871491 20:46344859-46344881 ATGGATGGGTAGATGGATGATGG - Intergenic
1173871527 20:46345034-46345056 ATGGAGGGGTAGATGGATGAAGG - Intergenic
1173908345 20:46645166-46645188 ATCGGAAGGTAATAGGATGATGG - Intronic
1174410202 20:50330340-50330362 ATGGGTGGGTGGATGGATGGAGG + Intergenic
1174967379 20:55233169-55233191 TTGGGTGGGAAGAAAGATGATGG + Intergenic
1174976822 20:55345035-55345057 AGAGGTAGGTAGAAAGAAGAAGG - Intergenic
1175683209 20:61006415-61006437 CTGGGTAGATTTAAGGATGAGGG + Intergenic
1175770482 20:61620263-61620285 ATGGGTGGGTAGATGGTTGATGG + Intronic
1175770498 20:61620398-61620420 ATGGATAGATAGATGGATGATGG + Intronic
1175770505 20:61620469-61620491 ATGGATAGATAGATGGATGATGG + Intronic
1175779305 20:61672173-61672195 ATGGGTGGGTATATGGATAATGG + Intronic
1175780280 20:61677782-61677804 ATGGATAGATACATGGATGATGG + Intronic
1175780301 20:61678028-61678050 ATAGGTAGATAGATGGATGATGG + Intronic
1175780310 20:61678142-61678164 ATAGGTAGATAGATGGATGATGG + Intronic
1175817291 20:61889913-61889935 ATGGGTAGATGGATCGATGATGG + Intronic
1175817363 20:61890306-61890328 ATGGATGGATAGATGGATGATGG + Intronic
1175817855 20:61892986-61893008 ATGGGTGAGTAGAGGGATGGTGG + Intronic
1175817876 20:61893069-61893091 ATGGGTGAGTAGAGGGATGCTGG + Intronic
1175935110 20:62510581-62510603 ATGGAGAGGTAGAGGGATGGAGG - Intergenic
1176455875 21:6909835-6909857 ATGGATAGTTAGATGGATAAGGG + Intergenic
1176834049 21:13774883-13774905 ATGGATAGTTAGATGGATAAGGG + Intergenic
1177744949 21:25200772-25200794 ATGGCCAAGTAGAAGGTTGAAGG - Intergenic
1179058271 21:37955781-37955803 ATGGGGAGATAAAAGCATGAAGG + Intronic
1179474718 21:41635819-41635841 ATGGATATATAGAGGGATGATGG - Intergenic
1179623673 21:42634925-42634947 ATGGATGGATAGAAGGATGATGG - Intergenic
1179623687 21:42635031-42635053 ATGGATGGAGAGAAGGATGATGG - Intergenic
1179623701 21:42635141-42635163 ATGGATGGAGAGAAGGATGATGG - Intergenic
1179623729 21:42635365-42635387 ATGGATGGATAGAAGGATGATGG - Intergenic
1179623741 21:42635471-42635493 ATGGATGGATAGAAGGATGATGG - Intergenic
1179623755 21:42635581-42635603 ATGGATGGAGAGAAGGATGATGG - Intergenic
1180024907 21:45155583-45155605 ATGGGTGAGTGGATGGATGATGG - Intronic
1180024982 21:45155912-45155934 ATGGGTGGGTGGGTGGATGATGG - Intronic
1180086080 21:45508483-45508505 ATGGGTGGGTGGATGGATGGTGG + Intronic
1181002465 22:19994314-19994336 ATGGGTGGGTGGAGGGATGGTGG + Intronic
1181037382 22:20176426-20176448 ATGTGGAGGGAGAAGGAAGAAGG - Intergenic
1181166524 22:20986728-20986750 ATAGGTAGATAGATAGATGATGG + Intronic
1181265194 22:21627010-21627032 ATGAGTGGGTAGAAGCAGGAAGG + Intergenic
1181536726 22:23550141-23550163 ATGGATGGGTAGTTGGATGATGG - Intergenic
1181536730 22:23550160-23550182 ATGGATGGGTAGATGGATGATGG - Intergenic
1181537227 22:23552741-23552763 ATGGGTGGGAGGAAAGATGAAGG - Intergenic
1181783195 22:25207608-25207630 GTGGGTGGGTGGAAGGATGATGG - Intergenic
1181971198 22:26691365-26691387 CTGGGTAGGTTGGAGGAGGATGG + Intergenic
1182086638 22:27565500-27565522 ATGGATAGATGGATGGATGATGG + Intergenic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182443897 22:30379459-30379481 GTGGGTGGGAGGAAGGATGAGGG - Exonic
1182458954 22:30470813-30470835 GTGGGTAGGTAGATGGAAAAAGG + Intronic
1183153116 22:36053602-36053624 ATGGGAAGGGAGAAGGGAGAAGG - Intergenic
1183304080 22:37072749-37072771 ATGGATGGATAGATGGATGATGG + Intronic
1183304094 22:37072821-37072843 ATGGATGGATAGACGGATGATGG + Intronic
1183304119 22:37072961-37072983 ACGGATGGGTGGAAGGATGATGG + Intronic
1183304122 22:37072980-37073002 ATGGATGGATAGATGGATGATGG + Intronic
1183304136 22:37073044-37073066 ATGGGTGGATGGATGGATGATGG + Intronic
1183304142 22:37073075-37073097 ATGGATGGATAGACGGATGATGG + Intronic
1183392945 22:37556215-37556237 ACAGGTAGGTAAATGGATGATGG + Intergenic
1183724882 22:39582977-39582999 ATGGGTGGGTGGATGGATGGAGG - Intronic
1183783030 22:40010887-40010909 TGGGGTAGGTATAAGGGTGAAGG - Intronic
1184292995 22:43508327-43508349 ATGGATAGATGGAAGGATGGGGG - Intergenic
1184434281 22:44460604-44460626 GTGGGTAGATGGATGGATGAGGG - Intergenic
1184444510 22:44539521-44539543 ATGGGTAGGTGGATGGTGGATGG + Intergenic
1184444604 22:44539903-44539925 ATGGGTAGGTGGACGGTGGATGG + Intergenic
1184731191 22:46372044-46372066 ATGGGTGGGTAGATGGATATAGG - Intronic
1184744648 22:46449248-46449270 ATGGGTGGGTTGATGCATGATGG - Intronic
1185053545 22:48566216-48566238 GATGGTAGGTAGATGGATGATGG + Intronic
1185053551 22:48566242-48566264 GATGGTAGGTAGATGGATGATGG + Intronic
1185053601 22:48566514-48566536 ATGGGTGAGTGGAAAGATGAAGG + Intronic
1185103701 22:48855388-48855410 ATGGATGGGTAGATGAATGATGG - Intergenic
1185163414 22:49243286-49243308 ATGGATAGATAGATGGATGGAGG + Intergenic
949405063 3:3705467-3705489 AGAGGGAGGGAGAAGGATGAGGG + Intronic
949519585 3:4837584-4837606 ATGGATAGGAAGCAGGATGCGGG + Intronic
949777335 3:7647557-7647579 ATGGGGAGTTGGAAGTATGAGGG + Intronic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
950184028 3:10934189-10934211 ATGGGTGGGTAGATGGCTGGAGG - Intronic
950573508 3:13816770-13816792 ATGGGTAGATGGATGGATGAAGG - Exonic
950983045 3:17329838-17329860 TTGGCAAGGTAGGAGGATGAGGG - Intronic
952556380 3:34535797-34535819 AATGCTAGGTAGAAGGTTGATGG - Intergenic
953091388 3:39729613-39729635 ATGGGAATGTAGTAGGATAATGG + Intergenic
954240074 3:49286770-49286792 ATGGATAGATGGATGGATGATGG - Intronic
954745781 3:52786878-52786900 ATGGATAGGTGAAAGGATGAGGG + Intronic
955410451 3:58652351-58652373 ATGGACAGGTGGAAGGATGCTGG - Intronic
955628247 3:60944077-60944099 ATTGTTAGGTGGTAGGATGAAGG - Intronic
955767141 3:62356743-62356765 ATGAGTAAGGAGAAGGATGGAGG + Intergenic
956621005 3:71221494-71221516 AAGGGAGGGCAGAAGGATGAAGG - Intronic
957274315 3:78070817-78070839 AGTAGTAGGAAGAAGGATGACGG + Intergenic
957795553 3:85001352-85001374 ATGGATAGATAGAAAGATAATGG - Intronic
958259609 3:91365141-91365163 GTGGGAATGTAGAAGGATAAAGG - Intergenic
959575143 3:107925876-107925898 ATGGATAGGAGGTAGGATGAGGG - Intergenic
959653822 3:108778542-108778564 ATGGATAGGGAGAAAGGTGAAGG + Intergenic
962439001 3:135394742-135394764 ATGGTGAGGTAGGAGCATGAGGG - Intergenic
962695397 3:137942745-137942767 ATGGATAATTAGAAGGCTGAAGG - Intergenic
962914830 3:139891539-139891561 CTGGGCAGGTAGAAGGAAGGAGG + Intergenic
963234713 3:142945532-142945554 ATGGGGAGGTGGAAGGGGGATGG + Intergenic
963704353 3:148666985-148667007 ATGGATAGTTGGATGGATGAAGG + Intergenic
967011655 3:185440782-185440804 ATGGGTTGGTAGCTGGCTGAAGG + Intronic
967884502 3:194323914-194323936 ATGGGCAGGCAGAAGGCTGCAGG + Intergenic
968594669 4:1476243-1476265 ATGGGTAGATGGATGGATGGTGG + Intergenic
968594734 4:1476501-1476523 GTGGGTGGGTAGATGGATGATGG + Intergenic
968598667 4:1498627-1498649 ATAGGTAGGGGGATGGATGATGG + Intergenic
968936037 4:3611041-3611063 ATGGATGGGTGGATGGATGATGG - Intergenic
969027277 4:4183589-4183611 ATGGGCAGGTAGGAAGATGCTGG + Intergenic
969088628 4:4675432-4675454 ATGGGTGGATAGATGGATGATGG - Intergenic
969256760 4:6007700-6007722 ATAGGTAGATGGATGGATGATGG + Intergenic
969501608 4:7556808-7556830 ATGGGTAGATGGATGGATGATGG - Intronic
969523098 4:7690211-7690233 ATGAGTGGGTGGATGGATGATGG + Intronic
969523145 4:7690466-7690488 ATGAGTGGGTGGATGGATGATGG + Intronic
969571584 4:8012087-8012109 ATGGATGGGCAGATGGATGATGG - Intronic
969624393 4:8294959-8294981 ATGGGTAAATGGATGGATGATGG - Intronic
969979455 4:11139610-11139632 ATGAGTGGGTAGATAGATGATGG + Intergenic
970904245 4:21196930-21196952 TTGAGTGGGAAGAAGGATGAGGG - Intronic
972714911 4:41635880-41635902 AGGGGTAGGTAGAAAGATAAAGG - Intronic
972718572 4:41673736-41673758 TGGGGTAGATAGGAGGATGAGGG + Intronic
974109339 4:57508918-57508940 ATGAGTAGGGAGAAGGAAGTAGG - Intergenic
974962838 4:68725013-68725035 ATGGATAGGTAGCAGAAGGAGGG + Intergenic
977708815 4:100101033-100101055 TAGGGGAGGTAGAAGGCTGAAGG + Intergenic
978240872 4:106514856-106514878 ATGGATAGATAGATGGATGATGG + Intergenic
978927037 4:114259333-114259355 ATGGGTAAGTGCAATGATGAGGG + Intergenic
980198813 4:129626967-129626989 ATGGGTAGGTAGAGGGAGAATGG + Intergenic
980824964 4:138062146-138062168 ATGGGGAAGTTTAAGGATGAGGG - Intergenic
983134135 4:164058627-164058649 ATGGGGAGGTGGCAGGATGCAGG - Intronic
983344872 4:166515531-166515553 ATGTGTGAGGAGAAGGATGATGG - Intergenic
984520533 4:180796374-180796396 ATGGGTAACTAGAAGGGGGATGG + Intergenic
984835321 4:184014249-184014271 AAGGGTATGTAGAAGGAAAAAGG + Intronic
985424198 4:189812594-189812616 ATGGGTAGGTAAAGGCATGGAGG - Intergenic
985709152 5:1418599-1418621 ATGGGTGGATGGATGGATGATGG - Intronic
985709199 5:1418825-1418847 ACGGGTGGGTGGATGGATGATGG - Intronic
985709239 5:1419023-1419045 ATGGATGGGTGGATGGATGATGG - Intronic
985820990 5:2160415-2160437 ATGGGTGGGTGGGTGGATGATGG - Intergenic
986770786 5:10971028-10971050 ATGGATAGGTAGATGGAGGTAGG - Intergenic
987063615 5:14266322-14266344 CTGGGTAGAAAGATGGATGAAGG - Intronic
987335854 5:16896988-16897010 ACGGGAAGGCAGAAGGAAGAAGG + Intronic
988732796 5:33990141-33990163 ATGGATGGGTGGATGGATGATGG - Intronic
990356867 5:54976207-54976229 GTGGATAGGTAGATAGATGAAGG - Intergenic
991104667 5:62830801-62830823 ATGGGTAGGTACCATGATGTAGG + Intergenic
992880012 5:81098447-81098469 ATGCATAGGTAGAAGTAAGAGGG + Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
992992494 5:82298432-82298454 ATGGGGAGCTGGAAGGGTGATGG + Intronic
993564029 5:89450405-89450427 GTGGGGAGCTAGAGGGATGAGGG + Intergenic
993812315 5:92496989-92497011 GTTGGAAGGTAGAAAGATGATGG - Intergenic
994184005 5:96798712-96798734 ATGGGTATTAAGAAGGATGAGGG - Intronic
994194076 5:96902154-96902176 GTGGGTAGTATGAAGGATGATGG + Intronic
995405111 5:111785896-111785918 ATGGATAGGGAGAGGGAAGAGGG + Intronic
996876258 5:128243597-128243619 ATGAGTGGATAGATGGATGATGG + Intergenic
996876286 5:128243718-128243740 GTGAGTAAGTAGATGGATGATGG + Intergenic
996929426 5:128868554-128868576 ATGGCTAAGGTGAAGGATGAAGG + Intronic
999524166 5:152384212-152384234 ATGGATAGATAGATGGATGATGG - Intergenic
999726339 5:154441361-154441383 ATGGATGGATAGATGGATGATGG - Intergenic
999733271 5:154492347-154492369 ATGGGAAGGTAAGAGGGTGAAGG + Intergenic
1000371212 5:160538379-160538401 ATGAGTACGTAGAAGGAAAATGG - Intergenic
1000439081 5:161246042-161246064 TTGGGTAGGTAAAAGGAAAAGGG - Intergenic
1000783613 5:165514889-165514911 ATGGATAGGTAGGAAGATTATGG - Intergenic
1001120185 5:168973735-168973757 AGGGCTAGGTAGGAGGAAGAGGG - Intronic
1001435443 5:171695868-171695890 ATGGGTGGGTGGATGGATGGTGG + Intergenic
1001751465 5:174134706-174134728 ATGGGTGGATGGATGGATGATGG - Intronic
1002113239 5:176935851-176935873 GTGGGTAGGTAGGAGGAGGTAGG - Intronic
1002298622 5:178245448-178245470 ATGGGTGGGTGGATGGATAATGG - Intronic
1002762648 6:214046-214068 ATGGGGAGCTGGAAGGAGGAGGG - Intergenic
1003025281 6:2549672-2549694 GTGGGTAGGAAAAGGGATGAAGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1005421379 6:25654922-25654944 TTGTGTAGGTACAAGAATGAAGG - Intronic
1005805573 6:29471424-29471446 ATGGGCAGGAAGAGGGAGGAGGG + Intergenic
1006557872 6:34884418-34884440 AAGGGTATATGGAAGGATGAAGG + Intronic
1007482928 6:42162044-42162066 CTGGGTAGGTGGAGGGATGGAGG + Intronic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010042073 6:71396768-71396790 AGGGGTAGGAAGAGGGAGGAGGG - Intergenic
1010419769 6:75659784-75659806 ATGGGTAGGCAGGAGGAAGGAGG - Intronic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1012587078 6:100936539-100936561 ATTGGGAGGTGGAAGGAGGAAGG + Intergenic
1013476109 6:110508791-110508813 ATGGGGAGCTAGAAGGGAGATGG - Intergenic
1017546577 6:155457846-155457868 ATGAGGAGGCAGAAGGATCAAGG - Intergenic
1018317458 6:162570809-162570831 TTGGGAAGGTAGAGGGAGGATGG + Intronic
1019479979 7:1261893-1261915 ATGGATAGATAGATGGATGATGG - Intergenic
1019777421 7:2920558-2920580 ATGGATACGTAGATGGATGATGG - Intronic
1019914734 7:4125396-4125418 ATGGATAGATGGATGGATGATGG + Intronic
1020447869 7:8287792-8287814 ATGGATAGTAAGAAGAATGAGGG - Intergenic
1021308716 7:19064474-19064496 ATGAGATGGTAGAAAGATGATGG - Intronic
1021628868 7:22623872-22623894 ATGGTTAGGAAGAAGGATGCTGG - Intronic
1022327073 7:29342180-29342202 ATGAATGGGTAGATGGATGAGGG + Intronic
1023545427 7:41313295-41313317 ATGGGAAGGGAGAAGTATGGTGG - Intergenic
1024297725 7:47859278-47859300 ATGGGGAGGGAGAAGGCTGTGGG - Intronic
1026248407 7:68644917-68644939 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
1026275188 7:68870217-68870239 ATGGATGGATAGATGGATGATGG + Intergenic
1026275397 7:68871784-68871806 ATGGATAGATAGACGGATGATGG - Intergenic
1026523336 7:71134392-71134414 AGGGGCAGGGAGAAGGAGGATGG + Intronic
1026828600 7:73598342-73598364 ATGGGTTGGTGGATGAATGATGG - Intronic
1026904276 7:74053907-74053929 ATGAATGGGTAGATGGATGAGGG + Intronic
1027163768 7:75820704-75820726 GTGGATGGGTAGATGGATGAAGG - Intronic
1027473173 7:78597653-78597675 ATGGTTAGGTAAAAGCAGGAAGG - Intronic
1027533581 7:79367140-79367162 ATGGGTAAGTGGAAGGAAGAGGG - Intronic
1027697655 7:81431926-81431948 TAGGGTTGGTAGAAGGGTGAGGG - Intergenic
1028770732 7:94617779-94617801 GTGGGTAGGTAAAAGGCAGATGG - Intronic
1029174795 7:98656999-98657021 ATAGGTAGGTAGATAGATAATGG + Intergenic
1031492770 7:122409752-122409774 CTGGGTTGGTAGGAAGATGAGGG + Intronic
1031719168 7:125148478-125148500 TTGGGCAGGGAGGAGGATGATGG + Intergenic
1032667279 7:134049296-134049318 ATGGGTGAGTGGAAGGATGAAGG - Intronic
1033893001 7:146038567-146038589 ATGGGTAGGAAGAAGCAATATGG - Intergenic
1034270412 7:149800934-149800956 ATGGGTAGATAGATGCATGGTGG - Intergenic
1034404203 7:150891345-150891367 AGGGGAAGGGAGAGGGATGAGGG + Intergenic
1034864287 7:154627680-154627702 ATGCGGAAGTTGAAGGATGATGG - Intronic
1034883646 7:154781049-154781071 ATGGGTGGATGGATGGATGATGG + Intronic
1035278924 7:157765326-157765348 ATGGATGGGTGGATGGATGATGG - Intronic
1035278929 7:157765345-157765367 ATGGATGGGTGAAAGGATGATGG - Intronic
1035279104 7:157766116-157766138 ATGGATAAGTAGATGGATGATGG - Intronic
1035279155 7:157766347-157766369 ATGGATGGGTAGATGGATGATGG - Intronic
1035279175 7:157766454-157766476 ATGGGTGGATAGATGGATGGAGG - Intronic
1035288524 7:157821985-157822007 ATGAGTAGATGGATGGATGATGG - Intronic
1035288587 7:157822445-157822467 ATGAGTGGATAGATGGATGATGG - Intronic
1035318719 7:158014444-158014466 ATGGATGGGTAGATGGATGGAGG - Intronic
1035318752 7:158014611-158014633 ATAGGTGGGTGGATGGATGAGGG - Intronic
1036658872 8:10694980-10695002 ATGGATAAGTGGAAGGATGATGG + Intronic
1037175889 8:15945438-15945460 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
1037887789 8:22604193-22604215 ATGGGGAGGTCGGAGGATAAGGG + Intergenic
1038404051 8:27308888-27308910 AAGGGTAGTTAGAATGAGGAGGG - Intronic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1039040210 8:33400497-33400519 AGGGGTGGATAGACGGATGAAGG + Intronic
1040546445 8:48401633-48401655 AGGGGTAGGAGGAAGGAGGAGGG + Intergenic
1042162157 8:65907497-65907519 ATAGGTAGGTTGAAGGAAAAAGG - Intergenic
1042330982 8:67580308-67580330 TTGTGTTGGTAGAAGGATTAGGG - Intronic
1043909484 8:85844613-85844635 ATGAGTGGGTGGATGGATGATGG + Intergenic
1045039868 8:98213201-98213223 CTGGGGAGGTTGAAGGAGGAGGG - Intronic
1045532088 8:102994689-102994711 AAAGGTAGGTATAAGGATAATGG - Intergenic
1045903180 8:107309603-107309625 ATGGGTAGGTATAGGGGTGAGGG + Intronic
1047061431 8:121231221-121231243 ATGTGAAGGTAGAGGGATGAAGG + Intergenic
1047306781 8:123659075-123659097 ATGGATGGATAGATGGATGATGG - Intergenic
1047306790 8:123659124-123659146 GTGGGTGGATAGATGGATGATGG - Intergenic
1047306802 8:123659191-123659213 ATGGATGGATAGATGGATGATGG - Intergenic
1048710233 8:137201626-137201648 ATGGGTGGATAGAAGGATGTTGG + Intergenic
1049083131 8:140457910-140457932 ATGGGGAGGGAGGAGGAGGAGGG + Intronic
1049096543 8:140551636-140551658 ATGGGTGGGTGGATGGTTGATGG + Intronic
1049096549 8:140551655-140551677 ATGGGTGGGTGGATGGTTGATGG + Intronic
1049096555 8:140551674-140551696 ATGGGTGGGTGGATGGTTGATGG + Intronic
1049096581 8:140551779-140551801 ATGGGTGGGTGGATGGTTGATGG + Intronic
1049155352 8:141062863-141062885 AGGAGTAGGTGGATGGATGATGG + Intergenic
1049223506 8:141438677-141438699 ATGGGTGGGTGGATGGATGGAGG + Intergenic
1049223581 8:141438997-141439019 GTGGGTGGGTGGATGGATGAAGG + Intergenic
1049350720 8:142163125-142163147 ATGGATGGATGGAAGGATGAAGG + Intergenic
1049350795 8:142163521-142163543 ATGGATGGATGGAAGGATGAAGG + Intergenic
1049359908 8:142207479-142207501 ATGGATAGGTGGATGGATGGGGG + Intergenic
1049359949 8:142207637-142207659 ATGGGTGGGTGGATGGATGGGGG + Intergenic
1049371953 8:142272225-142272247 ATGGGTAGATGGAAGGAGGAAGG - Intronic
1049371963 8:142272265-142272287 GTGGCTAGGTGGAAGGAGGAAGG - Intronic
1049372011 8:142272445-142272467 ATGGGTGGATGGAAGGAGGAAGG - Intronic
1049374966 8:142285074-142285096 ATGGGTAGATGAAAGGATGATGG + Intronic
1049464955 8:142746850-142746872 ATGGGTGGGTGGATGGATGGGGG + Intergenic
1050387739 9:5108853-5108875 ATGGGTAATTATAAGGGTGACGG - Intronic
1051709171 9:19912514-19912536 ATGGTTAGATAGATGGAGGAAGG - Intergenic
1052207663 9:25862884-25862906 ATAGGCAGGTAGAAGGACTAGGG + Intergenic
1052220077 9:26010187-26010209 CTGGATAGGTGGATGGATGACGG - Intergenic
1052993310 9:34535418-34535440 AGAGGGAGGTTGAAGGATGAAGG - Intergenic
1053007790 9:34615461-34615483 GGGGGTAGGTAGAAGGCAGAAGG + Intronic
1053199974 9:36145665-36145687 ATGGGTGGGTAGATGGAGGGAGG + Intronic
1055813673 9:80180464-80180486 AAAAGTAGGTAGAAGGAAGACGG - Intergenic
1056236159 9:84596879-84596901 ATGGGTAAGTAGAAGCTAGAGGG - Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1057713972 9:97474056-97474078 ATGGGTAAGGAGGAAGATGAAGG - Intronic
1058137671 9:101325375-101325397 ATGGGTAGGCTGAAGGTAGAGGG - Intergenic
1058233080 9:102454933-102454955 ACAGGTAAGTAGAAGGCTGAAGG + Intergenic
1058702984 9:107616129-107616151 ATGGGCAGATGGAAAGATGAAGG - Intergenic
1058747204 9:108003298-108003320 ATGGGTCTGGTGAAGGATGAAGG - Intergenic
1059252158 9:112895531-112895553 GTGGGTAGATGGATGGATGATGG - Intergenic
1059252230 9:112895801-112895823 ATGGGTAGATGGATGGATGATGG - Intergenic
1059339613 9:113590338-113590360 GTGGGTGGGTGGATGGATGAAGG - Intronic
1059416513 9:114165934-114165956 ATGGATAGATGGATGGATGATGG - Intronic
1059858949 9:118435288-118435310 ATGAATGGGTAGAAGGATGATGG - Intergenic
1060035275 9:120250205-120250227 GAGGGTACGTAGAAGGAGGATGG - Intergenic
1060597464 9:124856897-124856919 ATGGGTAGGTAGGAGCAGGATGG - Intronic
1060824354 9:126679477-126679499 ATGGGTGGATAGATGGTTGAAGG + Intronic
1060892398 9:127197080-127197102 ATGGGAAGCTAGAAGGAGGGAGG + Intronic
1061244773 9:129395854-129395876 ATGAGAAGGTGGAAGGAGGATGG + Intergenic
1061245102 9:129397533-129397555 ATGGATGGGTAGATGGATGATGG + Intergenic
1061417464 9:130454864-130454886 ATGGATGGGTGGATGGATGATGG - Intronic
1061417511 9:130455094-130455116 ATGGATGGATAGACGGATGATGG - Intronic
1061846718 9:133392448-133392470 GTGGGTAAGTGGATGGATGATGG + Intronic
1061962919 9:133997676-133997698 AGGGGCAGGTGGAGGGATGATGG - Intergenic
1061963178 9:133998493-133998515 ATGGATTGGTGGAAGGATGGAGG - Intergenic
1061963204 9:133998581-133998603 ATGGATTGGTGGAAGGATGGAGG - Intergenic
1061963230 9:133998669-133998691 ATGGATTGGTGGAAGGATGGAGG - Intergenic
1061963256 9:133998757-133998779 ATGGATTGGTGGAAGGATGGAGG - Intergenic
1061963282 9:133998845-133998867 ATGGATTGGTGGAAGGATGGAGG - Intergenic
1062092488 9:134685707-134685729 ATGGATGGATAGATGGATGATGG - Intronic
1062092506 9:134685793-134685815 ATGGATGGATAGATGGATGATGG - Intronic
1062201320 9:135304333-135304355 ATGAGTGGATAGATGGATGATGG + Intergenic
1062201393 9:135304644-135304666 ATGAGTGGATAGATGGATGATGG + Intergenic
1062247723 9:135578053-135578075 ATGGGTGGGTGGATGGATGGTGG - Intergenic
1062247792 9:135578399-135578421 ATGGGTGGGTGGATGGATGGTGG - Intergenic
1062247861 9:135578745-135578767 ATGGGTGGGTGGATGGATGGTGG - Intergenic
1185497379 X:565747-565769 ATGGGTAGATGGATGCATGATGG + Intergenic
1185497422 X:566017-566039 ATGGGTAGATGGATGTATGATGG + Intergenic
1185583090 X:1226126-1226148 ATGGGTGGGTGGAGGGAGGAAGG + Intergenic
1185583246 X:1226853-1226875 ATGGGTTGGTGGATGGATGGGGG + Intergenic
1185583282 X:1227017-1227039 ATGGGTTGGTGGATGGATGGGGG + Intergenic
1185611439 X:1395707-1395729 ATGGGTGGGTGGATGGATAATGG + Intergenic
1185613698 X:1407526-1407548 ATGGGTAGGTAGATGATGGATGG + Intronic
1185624530 X:1472964-1472986 ATGGGTGGGTGGATGGATGGGGG + Intronic
1185633070 X:1530082-1530104 ATGGATACATAGATGGATGACGG - Intronic
1185636768 X:1558579-1558601 ATAGGTAGGTAGATAGATGATGG - Intergenic
1185695855 X:2194007-2194029 ATAGGTAGGTAGACAGATGATGG - Intergenic
1185762735 X:2700950-2700972 GTGGGTGGGTAGACGGATGGAGG - Intronic
1185809407 X:3091839-3091861 ATAGGTAGATAGATAGATGATGG + Intronic
1185867840 X:3639225-3639247 GTGGGTGGGTGGATGGATGAAGG + Intronic
1185867876 X:3639321-3639343 GTGGGGTGGTAGATGGATGAAGG + Intronic
1185867893 X:3639367-3639389 GTGGGGTGGTAGATGGATGAAGG + Intronic
1185867951 X:3639516-3639538 GTGGGTGGGTGGATGGATGACGG + Intronic
1185867960 X:3639540-3639562 GTGGGTGGGTGGATGGATGAAGG + Intronic
1185928173 X:4170647-4170669 CTGGGGAGGAGGAAGGATGAAGG + Intergenic
1185939276 X:4297152-4297174 ATGGGTAGTCAAAAGGATTAGGG - Intergenic
1185973948 X:4697360-4697382 ATGGTTGGGTTTAAGGATGAAGG - Intergenic
1186017818 X:5217994-5218016 AGGGGTAGAGAGAAGGAGGAGGG + Intergenic
1187117901 X:16372189-16372211 AGGTGTAGGTAGTAGGACGAGGG - Intergenic
1187480180 X:19648235-19648257 ATGGGTAGGTGGAAGGAAGGAGG + Intronic
1187934109 X:24319314-24319336 TAGGGTAGGGGGAAGGATGAAGG + Intergenic
1188240663 X:27785109-27785131 ATTGGTAGATAGAAAGTTGATGG - Intergenic
1188759218 X:34004953-34004975 ATGGGAGGGTAGAAACATGAGGG - Intergenic
1188931279 X:36114308-36114330 ATGGATAGGAATAAGGATCATGG - Intronic
1190433827 X:50403992-50404014 GTGGGTAGATATAGGGATGAAGG - Intronic
1190445627 X:50520967-50520989 ATGGCCAGGTAGAAGTAGGAAGG + Intergenic
1190631293 X:52389432-52389454 ATGGGGAGCTAGAAGGTGGAGGG + Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1193738801 X:85193228-85193250 ATGGGGAGGAAAAATGATGATGG + Intergenic
1194695104 X:97037995-97038017 GTAGGTTGGGAGAAGGATGAGGG - Intronic
1194951228 X:100128829-100128851 ATGGGCAGGGAGGAGGATGTAGG + Intergenic
1195969553 X:110458403-110458425 AGAGGATGGTAGAAGGATGAAGG - Intergenic
1196024804 X:111030563-111030585 ATGGGTGGGTGGATGGATGAAGG + Intronic
1196645731 X:118116305-118116327 ATGCGAAGGTGTAAGGATGAGGG + Intronic
1197332733 X:125174067-125174089 AAGGGTAGCTGGAAGAATGATGG + Intergenic
1198102161 X:133431539-133431561 AGGGGTAGGAAGAGGGCTGAGGG + Intergenic
1198873893 X:141202889-141202911 CTGTATAGGTAGAAAGATGAGGG - Intergenic
1199794238 X:151179468-151179490 AGGGGGAGGGAGAAGGAGGAGGG - Intronic
1199857838 X:151774798-151774820 ATGGCTGGGGAGAAGGATGTGGG - Intergenic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic
1200917188 Y:8581708-8581730 CTGGGTTGGTTGCAGGATGATGG - Intergenic
1201289470 Y:12408675-12408697 ATGGGTGGATGGATGGATGATGG - Intergenic
1201305915 Y:12550408-12550430 ATGGGAAGGTGGATGGATGGGGG + Intergenic
1202586576 Y:26435153-26435175 AGCGGAAGTTAGAAGGATGAGGG + Intergenic
1202621914 Y:56822380-56822402 AGCGGAAGTTAGAAGGATGAGGG - Intergenic