ID: 901701299

View in Genome Browser
Species Human (GRCh38)
Location 1:11045995-11046017
Sequence CAAAAACGACGCAGGGGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901701299_901701303 -3 Left 901701299 1:11045995-11046017 CCTCGGCCCCTGCGTCGTTTTTG 0: 1
1: 0
2: 0
3: 4
4: 76
Right 901701303 1:11046015-11046037 TTGTTTTTTGTTTTTTGAGACGG 0: 357
1: 1413
2: 94594
3: 79063
4: 89440
901701299_901701304 18 Left 901701299 1:11045995-11046017 CCTCGGCCCCTGCGTCGTTTTTG 0: 1
1: 0
2: 0
3: 4
4: 76
Right 901701304 1:11046036-11046058 GGAGTCTAGCTCTGTCGCCCAGG 0: 392
1: 32093
2: 86068
3: 131309
4: 146054
901701299_901701305 22 Left 901701299 1:11045995-11046017 CCTCGGCCCCTGCGTCGTTTTTG 0: 1
1: 0
2: 0
3: 4
4: 76
Right 901701305 1:11046040-11046062 TCTAGCTCTGTCGCCCAGGCTGG 0: 641
1: 47306
2: 143088
3: 198688
4: 176179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901701299 Original CRISPR CAAAAACGACGCAGGGGCCG AGG (reversed) Intronic
901701299 1:11045995-11046017 CAAAAACGACGCAGGGGCCGAGG - Intronic
901983475 1:13054567-13054589 CAATAACGAGGCTGGGGCAGAGG - Intronic
901998614 1:13174351-13174373 CAATAACGAGGCTGGGGCAGAGG + Intergenic
902383271 1:16062431-16062453 CACAAAGGATGGAGGGGCCGTGG + Intronic
902684394 1:18066577-18066599 CAAAAACCACCCAGGGACCCAGG + Intergenic
903414008 1:23168934-23168956 AAAAAAGGACGGAGGGGGCGGGG - Exonic
903496693 1:23773228-23773250 CAAAACCGAGTCAGGGGCAGGGG + Intergenic
915418182 1:155758482-155758504 TAAAAATTAGGCAGGGGCCGTGG + Intronic
919434715 1:197543655-197543677 CAAAAAAAACGCAGAGGCTGAGG + Intronic
923001956 1:230013548-230013570 GAAAAATGAAGCAGGGGCGGGGG - Intergenic
1071819435 10:89264908-89264930 CACAAACAGCCCAGGGGCCGTGG - Intronic
1076028600 10:127138948-127138970 GAAAAACGATGCATGGACCGGGG - Intronic
1076167758 10:128295868-128295890 CAAAAACAAGGCAGGGGACGTGG - Intergenic
1076735953 10:132459051-132459073 CACACAGGACGCAGGGACCGCGG - Intergenic
1084295674 11:68212629-68212651 CAAAGGGGACGCAGCGGCCGCGG + Intronic
1091767284 12:3129965-3129987 CAAAGAAGACCCAGGGGCCTGGG - Intronic
1094019867 12:25902789-25902811 CAAAAACAAAGCAGGGGCAAGGG - Intergenic
1094731510 12:33181502-33181524 CAAAGATGACCCAGGGGCTGAGG - Intergenic
1102263597 12:111461670-111461692 AAAAAAGGAACCAGGGGCCGAGG + Intronic
1103007853 12:117436095-117436117 CAAAAACTACTCAGGGGCAGTGG + Intronic
1106619653 13:31361157-31361179 CAAAAACAATCCAGGGGCCAGGG - Intergenic
1113961577 13:114129095-114129117 CCAAAACAACGCCGTGGCCGTGG + Intronic
1115470707 14:33765867-33765889 CTAAATCGACACAGGGGCCTGGG - Intronic
1115739931 14:36377246-36377268 CATAAAGGATGCAGGGGCAGTGG - Intergenic
1118460384 14:65981706-65981728 CAGAAAGGAGGCAGGGGCGGAGG + Intronic
1118534108 14:66739508-66739530 AAAAAAAAAAGCAGGGGCCGGGG - Intronic
1122081099 14:99268543-99268565 CACAAATGATGCAGGAGCCGTGG - Intronic
1125728860 15:41881939-41881961 GAATAACGACGCCCGGGCCGAGG + Exonic
1126704584 15:51395581-51395603 CAAAAACAGCCCAGGGGCCTTGG + Intronic
1134525009 16:14936445-14936467 CAAAAACAAAACAGGGGCTGGGG - Intronic
1134547885 16:15124478-15124500 CAAAAACAAAACAGGGGCTGGGG + Intronic
1134712599 16:16334932-16334954 CAAAAACAAAACAGGGGCTGGGG - Intergenic
1134720463 16:16378243-16378265 CAAAAACAAAACAGGGGCTGGGG - Intergenic
1134946964 16:18333642-18333664 CAAAAACAAAACAGGGGCTGGGG + Intronic
1134954228 16:18373761-18373783 CAAAAACAAAACAGGGGCTGGGG + Intergenic
1135162406 16:20108922-20108944 CATAAACATCGCAGGGGTCGGGG - Intergenic
1140354998 16:74297665-74297687 TAAATACGACCCTGGGGCCGGGG - Intronic
1142389685 16:89790980-89791002 CAAAAACTACGCAGGTGTGGTGG - Intronic
1144570099 17:16392029-16392051 CAAAAGCGGGGCAGGGGCTGGGG + Intergenic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1150124058 17:62625527-62625549 CAAAGAAGACGCAAGGGCTGAGG - Intergenic
1152538667 17:80964029-80964051 AAAAAACCACGCAGGGCCCGGGG + Intronic
1160320046 18:77882025-77882047 CAAATAAGAAGCAGGGGCTGGGG + Intergenic
1160397407 18:78582694-78582716 CAGAAAGGATGCAGGGGCCCAGG + Intergenic
1162339931 19:10086273-10086295 CGAAAGCGAAACAGGGGCCGGGG + Exonic
1163157123 19:15445691-15445713 CAGAAAAGACTCAGGGGCTGAGG - Intronic
1164555667 19:29249012-29249034 CAGAAATGAGGCAGGGGCCTGGG - Intergenic
1166048853 19:40246099-40246121 AAAAAAAAAAGCAGGGGCCGGGG + Intronic
1167104560 19:47422309-47422331 CAAAAAAGACGGAGAGGGCGAGG - Intergenic
1167166810 19:47804205-47804227 CAAAAATTACCCAGGGGTCGTGG - Intronic
1167175026 19:47859559-47859581 CAAAAATTACCCAGGGGTCGTGG + Intergenic
1168590714 19:57632357-57632379 CTTAAACGACGCAGGGGTCAGGG + Intronic
1168660308 19:58160498-58160520 CAAAAACGGGCCAGGCGCCGTGG + Intergenic
924968938 2:106231-106253 CAATGAAGATGCAGGGGCCGGGG - Intergenic
926914674 2:17879835-17879857 CCAAAATGACCCAGGGGCCCTGG + Intronic
939102775 2:137914668-137914690 CAAAAATGACCCAGGTGCGGTGG + Intergenic
941873446 2:170409325-170409347 TAAAAAAGACGCAGCGGCGGAGG - Intronic
1178464605 21:32835336-32835358 CAAAAATGCCACAGGGGCTGTGG + Intergenic
954429441 3:50462234-50462256 CAAAAACGAGGCAGGTGTGGTGG + Intronic
954744690 3:52780468-52780490 CAGAAACCAGGCAGGGGCTGTGG + Intronic
959721479 3:109494998-109495020 CAAAAACTAGCCAGGGGCAGTGG + Intergenic
961785096 3:129342879-129342901 CAGAAAAGAGGCAGGGCCCGTGG + Intergenic
963921294 3:150908365-150908387 CAAGTACAAAGCAGGGGCCGTGG + Intronic
966672244 3:182540294-182540316 CAAAAACTAGCCAGGTGCCGTGG + Intergenic
981000323 4:139822929-139822951 CCAAAACCAGGCAGGGGCCTGGG + Intronic
985191314 4:187376452-187376474 CAAAAGCGTGGCAGGGGCAGTGG - Intergenic
989218874 5:38933051-38933073 CAAAACAGATGCAGGGGCCAGGG - Exonic
994999695 5:107111657-107111679 CAAACACCTGGCAGGGGCCGGGG + Intergenic
995953429 5:117744787-117744809 CAAAAATGAGGCAGGGACAGAGG + Intergenic
999252241 5:150189863-150189885 CAAAGACGACGCAGGGGGGTGGG + Intergenic
1020425071 7:8056008-8056030 CAAAAACCAGCCAGGGGCAGTGG + Intronic
1029601408 7:101565653-101565675 CAAATACAACGAAGGGGCCCTGG + Intergenic
1032270911 7:130404589-130404611 CATAAACAACGCAGGAGCAGGGG - Exonic
1033284126 7:140026266-140026288 CAAAAATGGCGCTGGTGCCGTGG + Exonic
1035244091 7:157551095-157551117 CAGAAACGACGCAGGGGAACTGG + Intronic
1037981232 8:23255912-23255934 CAAAAATTAGCCAGGGGCCGTGG - Intronic
1040875956 8:52152343-52152365 CAAAAAGGAGGGAGGGGCTGGGG + Intronic
1042592778 8:70413812-70413834 AACAAACAACCCAGGGGCCGAGG - Intergenic
1055308257 9:74952422-74952444 CAAAATCGACGCAGGGACCATGG - Exonic
1060775143 9:126367473-126367495 CAGAAACGAAGTAGGGGCAGAGG - Intronic
1186795440 X:13043617-13043639 CCAAAGCCACGAAGGGGCCGGGG + Intronic