ID: 901702898

View in Genome Browser
Species Human (GRCh38)
Location 1:11054871-11054893
Sequence CACATCATTCAGGGCCTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 235}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901702893_901702898 -10 Left 901702893 1:11054858-11054880 CCTGGGCTCAGCTCACATCATTC 0: 1
1: 1
2: 1
3: 24
4: 242
Right 901702898 1:11054871-11054893 CACATCATTCAGGGCCTGGAGGG 0: 1
1: 0
2: 4
3: 22
4: 235
901702890_901702898 13 Left 901702890 1:11054835-11054857 CCTGGGTGGCATCAGTGGTGGCG 0: 1
1: 0
2: 2
3: 30
4: 536
Right 901702898 1:11054871-11054893 CACATCATTCAGGGCCTGGAGGG 0: 1
1: 0
2: 4
3: 22
4: 235
901702887_901702898 20 Left 901702887 1:11054828-11054850 CCGAGGTCCTGGGTGGCATCAGT 0: 1
1: 0
2: 2
3: 23
4: 226
Right 901702898 1:11054871-11054893 CACATCATTCAGGGCCTGGAGGG 0: 1
1: 0
2: 4
3: 22
4: 235
901702885_901702898 27 Left 901702885 1:11054821-11054843 CCAAGGTCCGAGGTCCTGGGTGG 0: 1
1: 0
2: 1
3: 12
4: 174
Right 901702898 1:11054871-11054893 CACATCATTCAGGGCCTGGAGGG 0: 1
1: 0
2: 4
3: 22
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901702898 Original CRISPR CACATCATTCAGGGCCTGGA GGG Exonic
900265341 1:1754369-1754391 CACCTCATTCAGGACCTGGAGGG + Exonic
901702898 1:11054871-11054893 CACATCATTCAGGGCCTGGAGGG + Exonic
901749543 1:11397408-11397430 CACACCCTCCAGGGCCAGGAAGG - Intergenic
901883110 1:12205383-12205405 CAGATCAGACAGGGCCTGGTAGG + Intronic
902954873 1:19918742-19918764 CACAGCATTCAGGACCTTGAGGG - Intergenic
904039809 1:27577275-27577297 CAAATCATTCAGCTCCTGGTCGG + Intronic
904631682 1:31847428-31847450 CACATCACTCAGGGCCTTTCAGG + Intergenic
904865450 1:33575324-33575346 CACAGAATTCTGGGCCAGGAAGG - Intronic
905224016 1:36467615-36467637 CACATCATCCTGGGCCTGTTCGG - Exonic
905341538 1:37281797-37281819 CAGATTATGCAGGGCCTGGGAGG - Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
906390290 1:45409466-45409488 CAAATCATTTAGGGCCTGATAGG + Intronic
906784017 1:48598116-48598138 CAGATCACACAGGGCCTTGAAGG + Intronic
908755351 1:67464609-67464631 CACATTACGCTGGGCCTGGAAGG - Intergenic
915120343 1:153626620-153626642 CACATCAGTCTCAGCCTGGAGGG + Intronic
915558891 1:156675273-156675295 CAGATCGCTCAGGTCCTGGAAGG - Exonic
915592106 1:156876392-156876414 CGCCTCCTTCAGTGCCTGGATGG - Exonic
916521729 1:165569570-165569592 CACATCATTTAGGGCCTGGTGGG - Intergenic
916842886 1:168618008-168618030 CACATCATTCAGAGCCTTCTGGG + Intergenic
918119097 1:181521970-181521992 CACATCATTCAGGGCCTCGTTGG + Intronic
918327211 1:183421320-183421342 CAGATCATACAGGGCCTTGTAGG + Intergenic
920123415 1:203675456-203675478 ATCCTCATCCAGGGCCTGGAGGG - Intronic
920679617 1:208062560-208062582 AAGAGCATTCAGGGCCTGGATGG - Intronic
1063046478 10:2397647-2397669 CACATCATAGAGGGGCTAGATGG + Intergenic
1065679196 10:28211839-28211861 CAGATCACACAGGGCCTGAAAGG + Intronic
1066270005 10:33813136-33813158 CACATCAGACAAGGCCTGAAAGG + Intergenic
1069932410 10:71891647-71891669 CGCAGCATGCAGGCCCTGGAGGG + Intergenic
1071435240 10:85642914-85642936 CACATCATTGAGCCTCTGGAGGG - Intronic
1072239083 10:93478499-93478521 CAAATTACTCAGGGCCTGGTAGG - Intronic
1072300235 10:94053797-94053819 AACTTCATTCAGCGACTGGAAGG - Intronic
1074882235 10:117668050-117668072 CAAATCATTGATGGGCTGGAGGG + Intergenic
1075451863 10:122557290-122557312 TACAGGATTCAGGGACTGGAAGG + Intergenic
1075462524 10:122627018-122627040 CAGATCATTCAGGGCCTTGTGGG + Intronic
1076316173 10:129543312-129543334 CTCATCATTCACGACTTGGAAGG - Intronic
1077170937 11:1165434-1165456 CACATCCTTGGTGGCCTGGAGGG - Intronic
1077649366 11:3956078-3956100 CAGATCATTCTGGGCCTTGCAGG + Intronic
1079004823 11:16784130-16784152 CAGATCACTTAGGGCCTTGACGG - Intronic
1079797209 11:24820259-24820281 CTCATTATTCAGAGCCTGAAAGG + Intronic
1080600920 11:33819999-33820021 AACACCATTCAGCTCCTGGAAGG + Intergenic
1081591064 11:44423552-44423574 CTCATCACTCAGGGTCTGGAAGG - Intergenic
1081916003 11:46730570-46730592 CACTTCCTTTAGGGCCTGGAAGG + Intronic
1083155277 11:60819051-60819073 CCCATCCTTCAGGCCCTGGTGGG - Intergenic
1084427769 11:69094893-69094915 CACAACCTGCAGGGCCTGGGAGG - Intergenic
1084977538 11:72810860-72810882 CAGATCAAGCAGGGCCTTGAAGG + Intergenic
1086169009 11:83814605-83814627 CACATAATTAAGGGCCTCTATGG - Intronic
1086668072 11:89509771-89509793 CACAACAATCAGGGGTTGGAAGG + Intergenic
1090492402 11:127176404-127176426 TATATCAGTCAGGGCCTGGCAGG + Intergenic
1091663769 12:2403758-2403780 CACATCACTCAGGGGCTGCGTGG + Intronic
1091700150 12:2653827-2653849 CACATAGGGCAGGGCCTGGAAGG - Exonic
1091985417 12:4907318-4907340 CAGATCATGCAGGGCCTCTAAGG - Intergenic
1092200369 12:6578470-6578492 CTCATCATTCAGGTCCTTGGGGG + Exonic
1092999083 12:13978778-13978800 CAGATCATTCATGGGTTGGAGGG - Intronic
1093546798 12:20358214-20358236 CACTTTATTCAGGGCATAGATGG + Intergenic
1093920480 12:24854530-24854552 CACAGCATTCAAGCCCTGTATGG - Intronic
1095838337 12:46663461-46663483 CACATCCCACAGGGCCTGGTGGG + Intergenic
1095909270 12:47409372-47409394 CAGATCATGGAGGGCCTGGAAGG - Intergenic
1102000327 12:109553700-109553722 TACATAAATCAGTGCCTGGAAGG - Intergenic
1102315752 12:111885984-111886006 CACATTATCCAGGGCCTCGGTGG - Exonic
1102469537 12:113152004-113152026 CACCTCCTTCTGGGCCTGCAGGG - Exonic
1104225022 12:126823173-126823195 TACAAAATTCAGAGCCTGGAGGG - Intergenic
1105810927 13:23994527-23994549 CTCAGCATCCAGGGCCTGAAAGG - Intronic
1107053548 13:36078425-36078447 CAGATCATCAAGGGCTTGGAGGG - Intronic
1108600671 13:51991730-51991752 CTCACCATTCTGGGCCTGAAAGG + Intronic
1110999262 13:82157353-82157375 CACATCATTCAATCCCTTGAGGG - Intergenic
1111698974 13:91661843-91661865 CAGATCATTCAGGGCCCTGTGGG + Intronic
1112977931 13:105343917-105343939 CACATGATACAGGGACTGAAAGG - Intergenic
1113416581 13:110132927-110132949 CACATCATCCTGGCCCAGGAAGG + Intergenic
1114620000 14:24089993-24090015 CAGATCATGCAGAGCCTGGGAGG + Intronic
1117767876 14:59101726-59101748 CACATCATACAGGGGCTTGCAGG - Intergenic
1121752101 14:96365506-96365528 CACATCATGTAGGGCCTCGTAGG + Intronic
1122022783 14:98853219-98853241 CCCCTCAGTCAGTGCCTGGATGG - Intergenic
1122307978 14:100777434-100777456 CCCAGCAAGCAGGGCCTGGAAGG + Intergenic
1122696244 14:103554086-103554108 CACACCACTCAGGGCCTCGCAGG + Intergenic
1124370983 15:29104470-29104492 AACAGCACTCAGGGCCTGGCCGG - Intronic
1125102745 15:35933822-35933844 CAGATCATCCAGGGCCTTGTTGG + Intergenic
1127932762 15:63607931-63607953 CACAGCACTCAGGGCCCGCAGGG + Intergenic
1128256821 15:66202921-66202943 CAGTTCCTTCAGGCCCTGGAGGG - Intronic
1128315898 15:66659287-66659309 GACCTGATTCAGGACCTGGATGG + Intronic
1128685833 15:69684880-69684902 AACATCATACAGGGCCTGTCAGG - Intergenic
1129085278 15:73083072-73083094 CAAATAATTCAGGGCCTTGTTGG + Intronic
1129356330 15:74994536-74994558 CACACCATCCTAGGCCTGGAAGG - Intronic
1130251142 15:82301030-82301052 TACTTCATTCAGCCCCTGGACGG + Intergenic
1130358684 15:83159852-83159874 CAGATTATTTAGGGCCTTGAAGG + Intronic
1131623843 15:94097060-94097082 CAGAACATTCAGGGCCTTGTAGG + Intergenic
1132581048 16:684783-684805 CACATCATGAAGTGGCTGGAAGG - Exonic
1141164012 16:81648189-81648211 CACATCAGTGAGGGCCACGATGG - Intronic
1142325686 16:89413046-89413068 CCCATCAACCAGAGCCTGGAGGG + Intronic
1144703172 17:17351602-17351624 CACATCCCTCGGAGCCTGGAAGG - Intergenic
1148686482 17:49503852-49503874 CCCATCATTTAGGTCCTGGGAGG - Intronic
1149052161 17:52318635-52318657 CACATCATTCTGGGGCTTCATGG - Intergenic
1149203790 17:54219468-54219490 CAAATGATTAAGGGCCTGGTGGG + Intergenic
1149517011 17:57288394-57288416 CTAACCTTTCAGGGCCTGGAAGG - Intronic
1150266923 17:63837930-63837952 CACAGCATGCTGGGGCTGGAAGG - Intronic
1151167458 17:72217745-72217767 TACATGGTTGAGGGCCTGGAAGG - Intergenic
1151988651 17:77559926-77559948 CACACTGGTCAGGGCCTGGAAGG - Intergenic
1153128228 18:1822394-1822416 CACAACATTTGGGGCCTGGGTGG + Intergenic
1153156223 18:2152496-2152518 AACATCATCCAGCTCCTGGAGGG - Intergenic
1153536733 18:6109895-6109917 CAGATGACTCAGTGCCTGGAGGG - Intronic
1155028455 18:21963427-21963449 CACATCATTCTAGGCATTGAAGG - Intergenic
1157769894 18:50336923-50336945 CACATCATGCAGTGGCTGAAAGG - Intergenic
1160676335 19:393339-393361 CAGGTCATTCAGGGCCTGGTGGG + Intergenic
1160828028 19:1089772-1089794 CCCTTGATCCAGGGCCTGGAGGG - Intronic
1161286468 19:3471056-3471078 CAGGTCATTCAGGGCCTTGTGGG + Intergenic
1163476377 19:17528489-17528511 GACATCCCTCAGGGCCTGGCTGG - Intronic
1166645150 19:44526018-44526040 CACAGTCTTCAGGGCCTGGCAGG - Intronic
1167325087 19:48819479-48819501 CAGATCAGGCAGGGCCTTGAAGG - Intronic
1167690567 19:50982132-50982154 CACAGGAGGCAGGGCCTGGAGGG + Intronic
926107221 2:10160011-10160033 CTCATCACAGAGGGCCTGGAGGG - Intronic
927689948 2:25201507-25201529 CACATCATTTCGTACCTGGATGG - Intergenic
929325030 2:40599524-40599546 TACATCATTTAGGGCTTTGAAGG - Intronic
929642355 2:43594631-43594653 CAGATTATTTAGGGCCTTGAAGG - Intronic
929705992 2:44212468-44212490 CAAATCTTTCAGGGAGTGGAGGG - Intronic
930327437 2:49937613-49937635 CTCATCATTCAGGTGCGGGATGG - Intronic
931201950 2:60106094-60106116 CACATCATTCGGGCTCTGGTTGG - Intergenic
931440748 2:62288511-62288533 TACATCATTCTGGCCCTGGAAGG - Intergenic
932612484 2:73210165-73210187 CAGATCACCCAGGACCTGGAAGG - Intronic
932760893 2:74438589-74438611 CAGATCATGCAGGGCCTTGAAGG - Intronic
934717993 2:96554329-96554351 CCCAGCACCCAGGGCCTGGAGGG - Intergenic
936341001 2:111632759-111632781 CACATCATTCAGTGCAAGGTGGG - Intergenic
937058857 2:118966565-118966587 AAAAGCATTCTGGGCCTGGATGG + Intronic
938047902 2:128139726-128139748 CACATCATTCAGGGACTTGCAGG + Intronic
940986276 2:160055310-160055332 GGCATGATTCAGGGCCAGGAAGG + Intronic
943713761 2:191127069-191127091 CAAATCATCCAGAGACTGGATGG - Intronic
944749738 2:202696772-202696794 GAAATCATTCAGGGCCAGGCGGG + Intronic
944894674 2:204151769-204151791 CACATATCTCAGAGCCTGGAGGG + Intergenic
945213892 2:207412974-207412996 CACATGATTAAGGAGCTGGAGGG - Intergenic
945679785 2:212899895-212899917 CAGATCATTCAGGGCCTTATGGG + Intergenic
946096034 2:217274759-217274781 CACGTCATGGAGGGCCTGGCAGG - Intergenic
946232200 2:218298637-218298659 CACACTAAGCAGGGCCTGGAGGG + Intronic
946268585 2:218569607-218569629 CACATCATACAGGGCCGTGCAGG - Intronic
947513770 2:230783512-230783534 CACTTCATCCACTGCCTGGATGG - Intronic
948120880 2:235529590-235529612 CACAAAATCCAGGACCTGGAAGG + Intronic
1168958152 20:1849054-1849076 CAGATCACACAGGGCCTTGAAGG - Intergenic
1171481615 20:25459435-25459457 CACATTTTCCAGGCCCTGGAAGG + Intronic
1172129606 20:32646955-32646977 CACAGCCTTGAGGGCCAGGAGGG + Intergenic
1172441986 20:34972208-34972230 CAGATCATTCAGAGCCTTGAAGG - Intergenic
1172518223 20:35550651-35550673 CATATCATGCAGGGCTTGCAGGG + Intronic
1173587446 20:44193615-44193637 CAGATCATGGAGGGCCTGGTAGG - Intergenic
1174065339 20:47860644-47860666 CACACCATTCAGGGCCTTGCAGG - Intergenic
1174546746 20:51331460-51331482 CACCTCTTTCAGGCCCTGGATGG + Intergenic
1174997268 20:55584162-55584184 TACATTAATGAGGGCCTGGAAGG - Intergenic
1175416394 20:58804137-58804159 CACAACATCCAGAGCCTGGATGG + Intergenic
1175467943 20:59205267-59205289 CAAATCCTGCAGGGCCTGGGTGG - Intronic
1179328536 21:40375307-40375329 TACATCATTTAGTGCCTTGATGG + Intronic
1180013071 21:45064196-45064218 CACATCCTTCAGGCAGTGGAAGG + Intergenic
1180670428 22:17548687-17548709 CACATCAGTCCAGGCCTGCAGGG + Exonic
1180798463 22:18619597-18619619 CACATCTTCCTGGGCCAGGAGGG + Intergenic
1181064017 22:20297168-20297190 CCCAACATACAGGGCCTGGGTGG + Intergenic
1181223255 22:21375668-21375690 CACATCTTCCTGGGCCAGGAGGG - Intergenic
1181255484 22:21559958-21559980 CACATCTTCCTGGGCCAGGAGGG + Intronic
1183465526 22:37978350-37978372 CAAATCTTTCATGGGCTGGAGGG + Intronic
1184295534 22:43521829-43521851 CAAATCCTTCAGGGCATTGAAGG - Intergenic
1184349903 22:43936718-43936740 CACCTAGCTCAGGGCCTGGAAGG + Intronic
1184617395 22:45647285-45647307 CATATCATTCAGGACCTTCATGG - Intergenic
1185037812 22:48489100-48489122 CACCGCAGCCAGGGCCTGGAAGG - Intergenic
949842955 3:8340036-8340058 CACATCATTCAGGACCTTATAGG - Intergenic
951595364 3:24312750-24312772 CACATCACACAGGGCCTGGTAGG + Intronic
951813073 3:26722791-26722813 CACTGCATTCGGAGCCTGGAGGG + Intergenic
952341131 3:32448604-32448626 CATCTCATCCAGGGCCTGCAAGG + Intronic
952495621 3:33913564-33913586 CAGATCCTCCAGGGCCTGGTGGG - Intergenic
952762287 3:36925045-36925067 CACACCATTCAGTGGCTGAAAGG + Intronic
953722027 3:45364461-45364483 CACATCCTTCAGTGGCTGGAAGG - Intergenic
954848444 3:53579867-53579889 CACAGCATCCGGGGCCTGCATGG - Intronic
955137706 3:56236376-56236398 CTTCACATTCAGGGCCTGGATGG - Intronic
955552711 3:60101251-60101273 CACATTATGCAGGGCCTTGCAGG - Intronic
956391088 3:68773305-68773327 CACATCAGGCAAGGTCTGGAAGG + Intronic
956789358 3:72668714-72668736 CAAATTGTTCAAGGCCTGGAGGG + Intergenic
957819826 3:85357697-85357719 CTCACATTTCAGGGCCTGGAAGG + Intronic
959689431 3:109182632-109182654 CAGATCATGCAGGGCCTTGAAGG - Intergenic
963305436 3:143647106-143647128 CACCTAAATCAGGGCCTGGTGGG - Intronic
963829269 3:149989831-149989853 CACATCTTTAAGGTACTGGATGG + Intronic
964466227 3:156996442-156996464 CACATCATGCAGGGCCTTGCAGG + Intronic
965676768 3:171205786-171205808 CAGATCATTCAGGGCTTTGCAGG - Intronic
971942867 4:33238289-33238311 CTCAACATTCAGTGCCTCGAAGG - Intergenic
973656030 4:53048718-53048740 CAGATGACCCAGGGCCTGGAGGG - Intronic
973656213 4:53050763-53050785 CAGATGACCCAGGGCCTGGAGGG - Intronic
973686881 4:53378824-53378846 CACATCATCAAGGACCTGCATGG - Intronic
976585301 4:86790760-86790782 CAGATAATTCAGGGCCTTCAAGG + Intronic
976784134 4:88798640-88798662 CACATCATCTATGGCGTGGACGG - Intronic
976801191 4:88994002-88994024 AAAATCATTCATGGCCTGAATGG + Intronic
979456659 4:120933398-120933420 GACATCATTCTTGCCCTGGAGGG - Intergenic
981617916 4:146661891-146661913 CCCACCTTTCTGGGCCTGGAAGG + Intergenic
982063111 4:151624460-151624482 TTCACTATTCAGGGCCTGGAAGG + Intronic
983877243 4:172892114-172892136 CATAGAATTCAGGGTCTGGATGG - Intronic
986748619 5:10765221-10765243 CCCATCATGCAGGGTCTGGTAGG - Intergenic
987768188 5:22263263-22263285 AATATCATTCAGAGCCTGTAAGG + Intronic
987960924 5:24807412-24807434 CAGATAATTCAGGGCCTTGAGGG + Intergenic
989541905 5:42627902-42627924 CAGATCATACAGGGGCTCGAAGG + Intronic
991043276 5:62196937-62196959 CACATTATTAAGGGTATGGAAGG - Intergenic
991502172 5:67288078-67288100 CACATCTTCCTGGGCCTGCAGGG + Intergenic
992221422 5:74577350-74577372 AATATCATTCGTGGCCTGGAGGG + Intergenic
993790743 5:92207414-92207436 GACATGATTCAAGGCCTGAAGGG + Intergenic
995641441 5:114261788-114261810 CACATCATCCAGAGACTGGCAGG + Intergenic
995968653 5:117940527-117940549 CACCTCATTCAGGTCCTGACAGG - Intergenic
996669999 5:126106682-126106704 AACATCATTCAGAAGCTGGAAGG + Intergenic
997865954 5:137462992-137463014 CAAATCATTCAGGGGCTTCATGG + Intronic
999021870 5:148174658-148174680 AAAATAATTCAGGGCCTGAAGGG - Intronic
999870611 5:155746688-155746710 CACATCATCAAGGGGCAGGAAGG - Intergenic
1000261305 5:159591199-159591221 CACAACATTCAGAACATGGAAGG + Intergenic
1001186808 5:169581941-169581963 CACTTCAAGCAGGGCCTTGAAGG - Intergenic
1003065399 6:2900607-2900629 TCCATGATGCAGGGCCTGGAAGG + Exonic
1003236011 6:4295632-4295654 CAGATCCTACAGGGCCTGAAAGG + Intergenic
1004163280 6:13233255-13233277 AACTTCTTTCAGGGCATGGACGG - Intronic
1006392336 6:33765881-33765903 ACCAACATTCAGTGCCTGGAAGG - Intergenic
1006786613 6:36672039-36672061 CAGATCATTTAGGGACTAGAAGG - Intergenic
1007618723 6:43198620-43198642 CCCATCATCCAGGGTCAGGATGG + Exonic
1008310048 6:49956860-49956882 AGCATCATTCACGGCCTGCAAGG + Intergenic
1009296869 6:61961780-61961802 AAAATCATACAGGGCCTTGAAGG + Intronic
1010381993 6:75236156-75236178 CACATCAATTAGGGCCTTGTAGG - Intergenic
1012308085 6:97684435-97684457 AACATCAGTCAGGCACTGGAGGG + Intergenic
1013391901 6:109693716-109693738 CAAATCATTCATGGCCAGGGGGG + Intronic
1015228636 6:130887519-130887541 CAGATCATGCAGGGCCTTGGAGG - Intronic
1018570534 6:165205093-165205115 CACATAATTCAGGCTCTGGCTGG - Intergenic
1019193097 6:170265424-170265446 CACATCATCCTAGGCCTGCATGG + Intergenic
1021571645 7:22072096-22072118 CATTTCATTCAAGGGCTGGAGGG + Intergenic
1022454523 7:30546734-30546756 CACATCAGTCAGGATCTGGCAGG - Intronic
1025042752 7:55662415-55662437 CTCCTCCTTCAGGCCCTGGACGG - Intergenic
1026537739 7:71254051-71254073 GACATCAATCAGTGCATGGAAGG + Intronic
1026992388 7:74594521-74594543 CCCATCATCCAGGGCCTATATGG + Intronic
1029110905 7:98212590-98212612 GACTTCACGCAGGGCCTGGAAGG - Exonic
1029627745 7:101730886-101730908 GTCATCATGCACGGCCTGGAGGG - Intergenic
1029986957 7:104931252-104931274 CAAAACAATCAGGGCCTGGGTGG - Intergenic
1030016270 7:105225441-105225463 TACTTCATTCAGGACATGGAGGG - Intronic
1030360028 7:108586055-108586077 CACATCACTCAGGGCTTTCAAGG + Intergenic
1033125891 7:138706763-138706785 CACATCAGTTAGAGGCTGGAAGG + Intronic
1042001186 8:64124957-64124979 CACATCTTTCAAGTCCTTGATGG + Intergenic
1043879062 8:85520622-85520644 CACATCTTTCAGTGCCTCGTGGG - Intergenic
1044934473 8:97279448-97279470 CAGATCATACAGGGCCTTGCAGG - Intergenic
1045552976 8:103189071-103189093 CAACTAATTCAGTGCCTGGAAGG + Intronic
1047236810 8:123048845-123048867 CACATCATATAGGGCCTGGAAGG - Intronic
1049374156 8:142281135-142281157 CAGCTCAGTCAGGGCATGGAGGG + Intronic
1049469435 8:142768878-142768900 CTGCTCATTCAGGGCCTGGGAGG + Intronic
1050046960 9:1556874-1556896 CACATCCTGCAGGGCCTCCAAGG + Intergenic
1052201034 9:25780495-25780517 CACATCAATCAGGTACTGCAGGG - Intergenic
1057792952 9:98135994-98136016 CCCTGCCTTCAGGGCCTGGAGGG - Intronic
1057907931 9:98996752-98996774 CACCTCTTTCAGGCCCTGGGAGG + Intronic
1059348245 9:113646795-113646817 CAGATCACGCAGGGCCTTGAAGG - Intergenic
1060022754 9:120146498-120146520 AACAGCCTTCAGGCCCTGGATGG + Intergenic
1061119681 9:128635267-128635289 AACAGCATGCAGGGCCAGGATGG + Intronic
1061120741 9:128640877-128640899 CACATGATTCCTGGCCTGGGCGG + Exonic
1062099864 9:134722430-134722452 CACCTTATGCAGGGCCTGCAAGG + Intronic
1062384251 9:136302812-136302834 CTGAGCATTCAGGGGCTGGAGGG + Exonic
1062384608 9:136304223-136304245 CATGTCATTCTGGGCCTGGGCGG - Intronic
1062609570 9:137368009-137368031 CAGATTACTCAGGGCCTGGGAGG + Intronic
1186442869 X:9601140-9601162 TGGAACATTCAGGGCCTGGAGGG + Intronic
1186722695 X:12322577-12322599 CAGGTCATTCAGGGCCTTGTAGG + Intronic
1187412207 X:19061382-19061404 GACATCATTCAGGTCCTAGAGGG - Intronic
1188696858 X:33204245-33204267 CCAATCATTCAGAGCCTTGAAGG - Intronic
1188955916 X:36434895-36434917 CAAATCATTAAGTGCCTGGTAGG - Intergenic
1189751573 X:44228019-44228041 CACATCACTCAAGGCCTTGCTGG + Intronic
1189804891 X:44725403-44725425 CACATCCTTCAGAGCATGTATGG - Intergenic
1189897886 X:45674126-45674148 CACATCTTTCATGCCCTTGAGGG - Intergenic
1190598291 X:52067204-52067226 GACATCATTCTGGCCCAGGAAGG + Exonic
1190610533 X:52186869-52186891 GACATCATTCTGGCCCAGGAAGG - Exonic
1190981255 X:55458311-55458333 CACATTATGTAGGGCCTGGGAGG + Intergenic
1190987443 X:55514869-55514891 CACATTATGTAGGGCCTGGGAGG - Intergenic
1195251443 X:103051918-103051940 CAGATCTTACAGGGCCTGAAGGG + Intergenic
1196873468 X:120135565-120135587 CACACCATGCAGGGGCTGGAAGG - Intergenic
1197415909 X:126172532-126172554 CATATCATGCTGGGCCTGGTAGG - Intergenic
1197820364 X:130535274-130535296 CACACCATACAGTGGCTGGAAGG + Intergenic
1198320441 X:135514398-135514420 CAGATCATGCAGGGCCTAGTTGG - Intergenic
1199319321 X:146419809-146419831 CAGCTCATTCAGGGCCTGGTAGG + Intergenic