ID: 901702938

View in Genome Browser
Species Human (GRCh38)
Location 1:11055066-11055088
Sequence GCTCCTGGAAGTTCGTGCTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901702933_901702938 7 Left 901702933 1:11055036-11055058 CCACCTGCTGCTGTGTCAGCGGC 0: 1
1: 0
2: 1
3: 41
4: 654
Right 901702938 1:11055066-11055088 GCTCCTGGAAGTTCGTGCTCTGG 0: 1
1: 0
2: 1
3: 8
4: 101
901702934_901702938 4 Left 901702934 1:11055039-11055061 CCTGCTGCTGTGTCAGCGGCTGC 0: 1
1: 0
2: 3
3: 39
4: 362
Right 901702938 1:11055066-11055088 GCTCCTGGAAGTTCGTGCTCTGG 0: 1
1: 0
2: 1
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901702938 Original CRISPR GCTCCTGGAAGTTCGTGCTC TGG Exonic
900617929 1:3573662-3573684 GCTCCTGGAAGGGCGGGCTCTGG - Intronic
901702938 1:11055066-11055088 GCTCCTGGAAGTTCGTGCTCTGG + Exonic
905897519 1:41558290-41558312 ACTCCTGGACCTTCCTGCTCTGG + Intronic
907647056 1:56254728-56254750 CCTCCTAGCAGTTCATGCTCTGG + Intergenic
907743093 1:57185890-57185912 GCTTCTGGAATCTCGTACTCGGG - Intronic
916053070 1:161049423-161049445 GCTCCTGGGAGTTGGGCCTCAGG - Exonic
920347375 1:205315049-205315071 CCTCCTGCAAGTTTGTGCTCTGG + Intronic
921688883 1:218124213-218124235 GCTCCTGGAAGCTGCTACTCTGG + Intergenic
922494259 1:226043506-226043528 TCTCCAGGAAGTTCTTCCTCTGG + Intergenic
924437479 1:244054965-244054987 GCTCGCGGAAGTGCGTGCTCAGG - Exonic
1063209047 10:3862108-3862130 GCTCCTGGGGGTTCCTGCTGCGG + Intergenic
1065403666 10:25336796-25336818 TGTCCTGGAAGATGGTGCTCAGG + Intronic
1067248420 10:44566054-44566076 GCTCCTGGATGTTGGAGCCCTGG + Intergenic
1069800374 10:71078179-71078201 ACCTCTGGAAGTTTGTGCTCAGG + Intergenic
1070532620 10:77350396-77350418 GCACCTGGAAGCCCCTGCTCTGG - Intronic
1073859580 10:107722365-107722387 GCTACTTGTAGTTCTTGCTCGGG - Intergenic
1078005738 11:7531037-7531059 GCTCCTGGAAGTTTGTTAGCTGG - Intronic
1084037836 11:66523762-66523784 GCTCCAGGAGGTTCATGGTCAGG - Exonic
1084879833 11:72163071-72163093 GCCTCTGGAAGTTCGTGCTGAGG - Intergenic
1085849248 11:80100338-80100360 GCTCTAGGAAGTTAGTGCTTAGG - Intergenic
1087947403 11:104179814-104179836 GCCCCTGCAAGTACATGCTCTGG + Intergenic
1090748190 11:129723737-129723759 TCTCCTGCAGGTTCGTGCTTAGG + Intergenic
1092164991 12:6337015-6337037 GTTCCTGGAAGTGGGTGTTCAGG - Intronic
1104656395 12:130576685-130576707 GCTGCTGGCAGTTTGTGCTAAGG - Intronic
1113063746 13:106353784-106353806 GCCACTGGAAGTTCCTGCCCTGG - Intergenic
1113531642 13:111031906-111031928 GCTCCTGGAAGGTCTGGCTTGGG + Intergenic
1116603789 14:46963449-46963471 GGTCCTGCAAGTTCTGGCTCTGG + Intronic
1118396811 14:65344698-65344720 GTTCCTGGAAGTTCTTTCCCTGG + Intergenic
1125387936 15:39158118-39158140 GTTCCTGGAAGTCTGAGCTCAGG - Intergenic
1128216590 15:65938500-65938522 GCACCTGGAAGTTGATGCTTGGG + Intronic
1128703578 15:69821949-69821971 GCTCCTGGCAGCTGGTGTTCTGG - Intergenic
1129064455 15:72889425-72889447 GCTCCTGGAGGGTGGTGCCCAGG + Intergenic
1129270604 15:74417485-74417507 GCTCCTGGAAGTCCCTCCTCCGG + Intronic
1141495470 16:84406717-84406739 GCTCCCGGAAGTTGGGGTTCAGG + Intronic
1142358814 16:89616625-89616647 GTTCCTTGAAGTTTGTGATCAGG + Intronic
1145249285 17:21288489-21288511 GCTCCTGGAAGATGGTGATGTGG + Intronic
1145373278 17:22324694-22324716 GTTCCTGGAGGGTCGTGCCCAGG + Intergenic
1146970000 17:37064956-37064978 ACTCCTGGAAGCTCAGGCTCTGG + Intergenic
1147959511 17:44157917-44157939 GCTTCTGGGAGTTCTTCCTCAGG - Exonic
1148406966 17:47424039-47424061 GCTCCGGGAGGTGCGCGCTCGGG + Intronic
1152904605 17:82963333-82963355 CCTCCTGGAGGTTCGCGCTGGGG - Intronic
1154194396 18:12254893-12254915 CCTCCTGGAAGCGCGGGCTCTGG + Intronic
1155588887 18:27401695-27401717 GCTCTGCGAAGTTCGTGCTTAGG - Intergenic
1160761525 19:787821-787843 GCTCCTGGAGGTGACTGCTCAGG - Intergenic
1162126499 19:8502347-8502369 GCTCCTGGGGGTTCACGCTCAGG - Intronic
1163598185 19:18232633-18232655 GCTCCTGTACGTTCATGCTTGGG - Intronic
1165748953 19:38248446-38248468 GCTCCTGGATGCTCCTCCTCAGG + Intronic
1166278408 19:41772575-41772597 TCACCTTGAAGTTTGTGCTCTGG - Intergenic
1167327881 19:48836506-48836528 GATCCTGGAAGTCCGGCCTCGGG + Exonic
925680152 2:6411882-6411904 GCTCCTGGCTGTTCCTGCTTGGG + Intergenic
926055209 2:9770405-9770427 GCTCCTGGGAGTGCCTGCTAAGG + Intergenic
926669252 2:15560941-15560963 GGGGCTGGAACTTCGTGCTCTGG - Intronic
932575972 2:72962612-72962634 GGCCCTGGATGTTCCTGCTCAGG + Intronic
933864744 2:86505886-86505908 GCTCCTGGAGGTTCTGGCTCTGG + Exonic
935424062 2:102900849-102900871 CCTCATGGAAGTTCTTGTTCAGG + Intergenic
936041742 2:109155049-109155071 GCTCATGGAAGCTGGGGCTCTGG + Intronic
938047915 2:128139834-128139856 GCTTCTGGAAGTTGGTGCTCGGG + Intronic
946587051 2:221201463-221201485 GTTCACGGAAGTTCCTGCTCTGG - Intergenic
948270426 2:236669569-236669591 GCTGCAGGAAGTTCGTTCTTCGG + Intergenic
1174961508 20:55162340-55162362 GCTCCTGAAATTTTGTGCTGCGG - Intergenic
1179069854 21:38061201-38061223 GCTCCTGGAGCTTCCTTCTCAGG + Intronic
1181964568 22:26647556-26647578 GCTCCTGGAAGTGTGTGCCTGGG + Intergenic
1183397408 22:37579936-37579958 GCTCCTGGAGGCCTGTGCTCAGG + Exonic
1183813514 22:40278638-40278660 GCTCCTAGCAGTTGCTGCTCTGG + Intronic
1184924205 22:47625956-47625978 ACTCCAGGAAGATGGTGCTCTGG - Intergenic
950667394 3:14505742-14505764 GCTCCTGGGGGGTCGTGCCCCGG + Exonic
952558256 3:34558488-34558510 AGTCCTGGCAGTTCTTGCTCAGG + Intergenic
954030781 3:47818432-47818454 GCTCCTAGAAGTCCCTGATCAGG + Intronic
955687442 3:61561639-61561661 GCTCCTGAAAGTTGTGGCTCCGG - Intronic
958517400 3:95135461-95135483 TGTCCTGGAAGTGCTTGCTCTGG + Intergenic
959038094 3:101388002-101388024 CCTCCTGGAAGTTCGGGGACTGG + Intronic
959359178 3:105367709-105367731 TCTCCAGGAACTTGGTGCTCCGG + Intronic
962744436 3:138387186-138387208 GGCCCTGGAAGTTGATGCTCAGG + Intronic
964212779 3:154246617-154246639 GTTCCTGGAACTTCCTGCTATGG - Intronic
964853657 3:161121756-161121778 GCTCCTGGAAGTTCAGGCTAGGG + Intronic
968591146 4:1460222-1460244 GCTGCTGGAAGTTGGGGCTGAGG - Intergenic
969848080 4:9935415-9935437 GCTCCTGGAAGCAGGTGTTCGGG - Intronic
970786684 4:19805484-19805506 GATCCTGGAAGTTCAAACTCAGG + Intergenic
977418371 4:96764214-96764236 GCTCCTGGTAGTTGGTCCTCAGG + Intergenic
990537089 5:56733502-56733524 GCACCCGGAAGTCCCTGCTCTGG + Intergenic
998170768 5:139870921-139870943 GCTCCTTGGAGTTCCTGCTGGGG + Intronic
999098043 5:148998785-148998807 GCTGCTGGAAGTGCTGGCTCTGG - Intronic
1007496291 6:42262086-42262108 GCCCAGGGAAGTTCGTGCTTTGG - Intronic
1011996489 6:93595622-93595644 GCTCCTGGAAATTCATGTACAGG + Intergenic
1012229624 6:96745599-96745621 GCTACTTGCACTTCGTGCTCTGG - Intergenic
1012453805 6:99382144-99382166 GTTCCTGGAACATGGTGCTCAGG + Intronic
1012976490 6:105785805-105785827 GCTCCTGAAAGCTGTTGCTCTGG + Intergenic
1015933780 6:138388220-138388242 GTTCCTGGAGGTTTCTGCTCAGG - Intergenic
1016516942 6:144904426-144904448 GCTCCTGTAAGTCATTGCTCAGG - Intergenic
1018419227 6:163627813-163627835 GCTCCTGGAACTCCGTGTGCAGG + Intergenic
1020798167 7:12700988-12701010 GCTCCTGGAGGCTGGTGGTCAGG - Intergenic
1023687779 7:42754119-42754141 GCTCCAGGAAGCTTGGGCTCAGG - Intergenic
1024580069 7:50793689-50793711 GCTCCCGGAGGTTCCTGCCCCGG + Intergenic
1024698888 7:51885456-51885478 TCTCCTGGAAGGTCTTGCTTAGG + Intergenic
1030176722 7:106661280-106661302 GTTCCTGGAAGATGGTGCTGGGG + Intergenic
1033535350 7:142307433-142307455 CCTCCTGGAGGTTCCTGCCCTGG + Intergenic
1034034477 7:147804497-147804519 GCACCTTGAAGGTCATGCTCAGG - Intronic
1041038438 8:53820220-53820242 GCTCCCTGTAGCTCGTGCTCTGG - Intronic
1049562300 8:143317807-143317829 GCTCCTGGAGGTGCTTGTTCAGG + Exonic
1049742674 8:144248636-144248658 GCTCCTGGAAGGTGGTGCCTGGG - Intronic
1053797492 9:41739927-41739949 GTTCCTGGAGGGTCGTGCCCAGG - Intergenic
1054147696 9:61575016-61575038 GTTCCTGGAGGGTCGTGCCCAGG + Intergenic
1054185904 9:61951979-61952001 GTTCCTGGAGGGTCGTGCCCAGG - Intergenic
1054467444 9:65506063-65506085 GTTCCTGGAGGGTCGTGCCCAGG + Intergenic
1054652601 9:67636540-67636562 GTTCCTGGAGGGTCGTGCCCAGG + Intergenic
1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG + Exonic
1058205214 9:102097185-102097207 GCTCCAGGCAGTTCATCCTCAGG - Intergenic
1062137787 9:134938805-134938827 GCTCCTGGAACTTGGAACTCTGG + Intergenic
1062216592 9:135392800-135392822 GCTCTTAGAAGCTCCTGCTCTGG - Intergenic
1185617808 X:1433927-1433949 GCTCCTGCAAGCACCTGCTCAGG - Intronic
1199744300 X:150762039-150762061 GCTTCTGGCAGATCCTGCTCCGG + Intronic