ID: 901704806

View in Genome Browser
Species Human (GRCh38)
Location 1:11065354-11065376
Sequence TGTTTTAGCTAGGACTAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901704806_901704813 26 Left 901704806 1:11065354-11065376 CCAGTCTAGTCCTAGCTAAAACA No data
Right 901704813 1:11065403-11065425 TGTTCTCTGCTGTTCAAGAGTGG No data
901704806_901704814 27 Left 901704806 1:11065354-11065376 CCAGTCTAGTCCTAGCTAAAACA No data
Right 901704814 1:11065404-11065426 GTTCTCTGCTGTTCAAGAGTGGG No data
901704806_901704809 1 Left 901704806 1:11065354-11065376 CCAGTCTAGTCCTAGCTAAAACA No data
Right 901704809 1:11065378-11065400 ACTCCAGCCTATCTTAGGACAGG No data
901704806_901704808 -4 Left 901704806 1:11065354-11065376 CCAGTCTAGTCCTAGCTAAAACA No data
Right 901704808 1:11065373-11065395 AACAAACTCCAGCCTATCTTAGG No data
901704806_901704810 2 Left 901704806 1:11065354-11065376 CCAGTCTAGTCCTAGCTAAAACA No data
Right 901704810 1:11065379-11065401 CTCCAGCCTATCTTAGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901704806 Original CRISPR TGTTTTAGCTAGGACTAGAC TGG (reversed) Intergenic