ID: 901704807

View in Genome Browser
Species Human (GRCh38)
Location 1:11065364-11065386
Sequence GGCTGGAGTTTGTTTTAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901704807_901704813 16 Left 901704807 1:11065364-11065386 CCTAGCTAAAACAAACTCCAGCC No data
Right 901704813 1:11065403-11065425 TGTTCTCTGCTGTTCAAGAGTGG No data
901704807_901704815 30 Left 901704807 1:11065364-11065386 CCTAGCTAAAACAAACTCCAGCC No data
Right 901704815 1:11065417-11065439 CAAGAGTGGGAGCTCTCTGACGG No data
901704807_901704810 -8 Left 901704807 1:11065364-11065386 CCTAGCTAAAACAAACTCCAGCC No data
Right 901704810 1:11065379-11065401 CTCCAGCCTATCTTAGGACAGGG No data
901704807_901704809 -9 Left 901704807 1:11065364-11065386 CCTAGCTAAAACAAACTCCAGCC No data
Right 901704809 1:11065378-11065400 ACTCCAGCCTATCTTAGGACAGG No data
901704807_901704814 17 Left 901704807 1:11065364-11065386 CCTAGCTAAAACAAACTCCAGCC No data
Right 901704814 1:11065404-11065426 GTTCTCTGCTGTTCAAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901704807 Original CRISPR GGCTGGAGTTTGTTTTAGCT AGG (reversed) Intergenic